Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:1,248Public Records:521
Specimens with Sequences:1,194Public Species:39
Specimens with Barcodes:1,163Public BINs:28
Species:145         
Species With Barcodes:137         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa sp. 4YB

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa debilisDHJ01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa citrinaDHJ02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa maroniensisDHJ02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 36
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa citrinaDHJ04

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 19
Specimens with Barcodes: 64
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Lophocampa modestaDHJ02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNTGGAACCTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGGAATCCTGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAATTCCTTTAATAATAGGAGCCCCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGACTTCTTCCCCCATCTTTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGCCCATGGTGGTAGATCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCCTCTATTTTAGGAGCAATTAACTTTATTACAACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTTGTATGAGCTGTAGGAATTACAGCATTTTTATTATTATTATCTTTACCAGTATTAGCAGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGACCCAGCTGGAGGAGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa modestaDHJ02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Lophocampa modestaDHJ01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 56 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNTGGAACCTTATATTTTATTTTTGGAATTTGAGCAGGGATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGGAATCCTGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAATTCCTTTAATAATAGGAGCCCCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGACTTCTTCCCCCATCTTTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCTCTTTCATCTAATATTGCCCATGGTGGTAGATCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCCTCTATTTTAGGGGCAATTAACTTTATTACAACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTTGTATGAGCTGTAGGAATTACAGCATTTTTATTATTATTATCTTTACCAGTATTAGCAGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGACCCAGCTGGAGGAGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa modestaDHJ01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 45
Specimens with Barcodes: 56
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa propinquaBE03

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa propinquaBE02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa propinquaBE01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa Espinoza06

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa catenulataBE02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa catenulataBE01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa pectina CR1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa maroniensis CR1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa EspinozaF12

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa EspinozaF11

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa EspinozaF09

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa EspinozaF08

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa EspinozaF06

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa EspinozaF04

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa EspinozaF01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa modestaBE01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Lophocampa maroniensisDHJ05

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNTGGAACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATAATAGGAGCTCCTGATATAGCATTTCCTCGAATAAATAATATAAGTTTTTGACTTCTTCCCCCATCTTTAACTTTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCCAATATTGCTCATGGTGGTAGATCTGTAGATTTAGCCATTTTTTCTTTACATTTAGCAGGTATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCATTATTTGTATGAGCTGTAGGAATTACAGCATTCTTATTATTACTTTCTTTACCAGTATTAGCAGGAGCAATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGACCCAGCTGGTGGGGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa maroniensisDHJ05

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Lophocampa debilisDHJ02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTAGGAACCTCATTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGTAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGACTTTTACCCCCATCTTTAACTTTATTAATTTCAAGAAGAATTGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa debilisDHJ02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Lophocampa debilisDHJ01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNAACTTTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACCTCATTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGTAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGACTTTTACCCCCATCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACGGTTTACCCCCCCCTTTCATCTAATATTGCTCATAGAGGAAGATCAGTAGATTTAGCAATTTTTTCTCTTCATTTAGCAGGAATTTCTTCTATTCTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCATTATTTGTCTGAGCAGTAGGAATTACAGCATTTTTATTATTACTTTCTTTACCAGTATTAGCAGGAGCAATTACAATATTATTAACTGATCGAAATTTAAATACATCATTCTTTGACCCTGCTGGAGGAGGAGACCCTATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Lophocampa maroniensisDHJ04

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

NNAACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGCTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATAATAGGAGCTCCTGATATAGCATTTCCTCGAATAAATAATATAAGTTTTTGACTTCTTCCCCCATCTTTAACTTTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCCAATATTGCCCATGGTGGTAGATCTGTAGATTTAGCCATTTTTTCTTTACATTTAGCAGGTATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCATTATTTGTATGAGCTGTAGGAATTACAGCATTCTTATTATTACTCTCTTTACCAGTATTAGCAGGAGCAATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGACCCAGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa maroniensisDHJ04

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Lophocampa maroniensisDHJ03

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 30 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNAACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGCTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATAATAGGAGCTCCTGATATAGCATTTCCTCGAATAAATAATATAAGTTTTTGACTTCTTCCCCCATCTTTAACTTTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCCAATATTGCTCATGGTGGTAGATCTGTAGATTTAGCCATTTTTTCTTTACATTTAGCAGGTATTTCTTCAATTTTAGGAGCAATTAACTTTATTACAACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCATTATTTGTATGAGCTGTAGGAATTACAGCATTCTTATTATTACTTTCTTTACCGGTATTAGCAGGAGCAATTACTATATTATTAACGGATCGAAATTTAAATACATCATTTTTTGATCCAGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa maroniensisDHJ03

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 20
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Lophocampa maroniensisDHJ02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 34 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNTGGAACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGAAACCCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATAATAGGAGCTCCTGATATAGCATTTCCTCGAATAAATAATATAAGTTTTTGACTTCTTCCCCCATCTTTAACTTTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCCAATATTGCTCATGGTGGTAGATCTGTAGATTTAGCCATTTTTTCTTTACATTTAGCAGGTATTTCTTCAATTTTAGGAGCAATTAACTTTATTACAACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCATTATTTGTATGAGCTGTAGGAATTACAGCATTCTTATTATTACTTTCTTTACCAGTATTAGCAGGAGCAATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCAGCTGGAGGAGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Lophocampa citrinaDHJ04

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 58 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNTGGAACTTTATATTTTATTTTTGGTGTTTGAGCAGGTATAGTAGGAACCTCATTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGTTTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGTATAAATAATATAAGTTTTTGACTTTTACCCCCATCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCTCACGGAGGTAGATCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGCAGGAATTTCTTCCATTCTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGATTAAATAACTTATCCTTTGATCAAATACCATTATTTGTTTGAGCAGTAGGAATTACAGCATTTTTATTATTACTTTCTTTACCAGTATTAGCAGGAGCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa Espinoza08

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa Espinoza05

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa Espinoza03

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa Espinoza02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa BioLep05

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa BioLep04

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa BioLep03

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa BioLep02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Lophocampa citrinaDHJ01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGTGTTTGAGCTGGTATAGTAGGAACCTCATTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGTAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGACTTCTACCCCCATCTTTAACTTTACTAATTTCAAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACGGTTTACCCCCCCCTTTCATCTAATATTGCTCATGGAGGCAGATCAGTAGATTTAGCTATTTTTTCCCTTCATTTAGCAGGAATTTCTTCCATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCATTATTTGTTTGAGCCGTAGGAATTACAGCATTTTTATTATTACTTTCTTTACCAGTTTTAGCAGGAGCAATTACAATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGACCCTGCTGGAGGGGGAGATCCTATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa citrinaDHJ01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophocampa citrinaDHJ03

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Lophocampa citrinaDHJ02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 24 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNTGGAACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACCTCGTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGCTTTGGTAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGACTTTTACCCCCATCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCAGGTACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCTCATGGAGGTAGATCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGCAGGAATTTCTTCTATTCTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGATTAAATAATTTATCTTTTGATCAAATNCCATTATTTGTTTGAGCAGTAGGAATTACAGCATTTTTATTATTACTTTCTTTACCAGTTTTAGCAGGAGCAATTACTATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Lophocampa

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lophocampa

Lophocampa is a genus of moth in the family Arctiidae.[1] It contains 10 subspecies and around 75 species.[2]

Species[edit]

The following are species classified under Lophocampa.[3]

References[edit]

  1. ^ Lophocampa at funet
  2. ^ Benoit Vincent (2011). "Description of two new Lophocampa Harris from the Dominican Republic (Arctiidae, Arctiinae)". ZooKeys (Pensoft) (75): 69–77. doi:10.3897/zookeys.75.838. 
  3. ^ Natural History Museum Lepidoptera generic names catalog
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!