Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

White Clover (Trifolium repens) is a familiar weedy herbaceous plant with sprawling stems that is native or naturalized across most of the temperate regions of the world. The white or pinkish flowers are produced in heads consisting of dozens of flowers. It is a perennial and an insect-pollinated, obligate outcrosser; plants also spread vegetatively by stolons (Olsen et al. 2008). Like other plants in the Fabaceae (legume family), White Clover harbors microbes in its root system that are capable of fixing nitrogen, i.e., converting atmospheric nitrogen into a form that is usable by plants. White Clover is one of the three-leafleted clover species that occasionally produces a leaf with four (or more) leaflets, i.e., a "four-leafed clover". The genetics underlying this phenomenon has been at least partly worked out (see Tashiro et al. 2010). Images of four-leafed clovers can be seen above and examples of multifoliolated clover leaves can be seen here, along with this intriguing quotation from Masters (1869): "[Trifolium repens] was gathered at night-time during the full moon by sorceresses, who mixed it with vervain and other ingredients, while young girls in search of a token of perfect happiness made quest of the plant by day."

White Clover exhibits a geographic polymorphism for cyanogenesis (the release of cyanide following tissue damage, a phenomenon seen in a very large and diverse number of plant species). Both cyanogenic and acyanogenic plants occur in natural populations, with acyanogenic plants predominating in colder climates for reasons that are not yet clear (Olsen and Ungerer 2008; Olsen et al. 2008 and references therein). This polymorphism has been studied since early in the 20th century, and represents one of the most thoroughly studied examples of an adaptive polymorphism in plants. Cyanogenic plants are generally found to be strongly favored in the presence of generalist herbivores, which avoid eating them. However, a number of costs appear to be associated with cyanogenesis, such as reduced drought tolerance, resulting in trade-offs that may favor cyanogenetic or acyanogenetic plants depending on local conditions. (Olsen et al. 2008 and references therein)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

This perennial plant is about 6' tall, branching from the base. Initially, it produces several compound leaves from a short stem that grows only a little, after which this stem rapidly elongates and becomes up to 1' long. These elongated stems sprawl along the ground and have the capacity to root at the nodes. They are hairless and light green. The alternate compound leaves are trifoliate and hairless. They occur at intervals along the elongated stems and have long hairless petioles. The leaflets are obovate or ovate. Their margins are finely serrate. Across the upper surface of each leaflet are white markings in the form of a chevron (an upside down 'V'), although for this species these markings are often degenerate, irregular, or absent. Each leaflet is about ¾' long and about half as wide. At the base of each petiole there are a pair of small lanceolate stipules that are light green and membranous; sometimes they wrap around the elongated stems. Each stipule is less than ½' in length.  Flowerheads about ¾' across are produced on long naked stalks (peduncles) that are unbranched and hairless. These flowering stalks are usually a little taller than the compound leaves. Each flowerhead has 20-50 flowers and is more or less globular in shape. Each flower is narrowly tubular, consisting of a green calyx with 5 narrow teeth and 5 petals that are white or pinkish white. When fully open, there is a small standard and 2 side petals that enclose the keel. The teeth of the calyx are equal to, or less than, the length of the calyx tube. Each flower has a very short pedicel. The blooming period occurs intermittently for several months, from late spring through the fall. The flowers gradually turn brown and are replaced by seedpods. Each little seedpod contains only a few seeds, which are flat, round or slightly heart-shaped, and variously colored. The root system consists of a shallow branching taproot and the rootlets formed by the elongated stems. This plant reproduces by seed or vegetatively, and often forms colonies.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Perennial herb with stems creeping and rooting at the nodes (hence forming extensive patches). Leaflets 3(-4), obovate or obcordate, with a whitish angled band near the base, borne on a long (-14 cm) petiole. Flowers white, borne in heads. Calyx-tube white with green veins; teeth triangular. Pedicels deflexed after flowering. Pod 3-6-seeded.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Mark Hyde, Bart Wursten and Petra Ballings

Source: Flora of Zimbabwe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Derivation of specific name

repens: creeping
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Mark Hyde, Bart Wursten and Petra Ballings

Source: Flora of Zimbabwe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Trifolium repens,L, white clover, is a perennial legume that originated in Europe and has become one of the most widely distributed legumes in the world. It has a prostrate, stoloniferous growth habit. The leaves are composed of three leaflets, which may or may not have a “crescent” or “water mark” on the upper surface. Leaves and roots develop along the stolon at the nodes.

The flower heads, each consisting of 40 to 100 florets, are borne on long stalks from the leaf axils. Florets are white but may have a pink hue.

Public Domain

USDA NRCS Plant Materials Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Widely naturalised in the temperate regions of the world; native of Europe, N. Africa, W. & C. Asia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

White clover has a circumboreal distribution. It was introduced in
North America from Europe and has naturalized throughout Canada and the
United States, including Hawaii and Alaska [12,15,41].
  • 41. Welsh, Stanley L.; Atwood, N. Duane; Goodrich, Sherel; Higgins, Larry C., eds. 1987. A Utah flora. Great Basin Naturalist Memoir No. 9. Provo, UT: Brigham Young University. 894 p. [2944]
  • 12. Gleason, Henry A.; Cronquist, Arthur. 1991. Manual of vascular plants of northeastern United States and adjacent Canada. 2nd ed. New York: New York Botanical Garden. 910 p. [20329]
  • 15. Hardy BBT Limited. 1989. Manual of plant species suitability for reclamation in Alberta. 2d ed. Report No. RRTAC 89-4. Edmonton, AB: Alberta Land Conservation and Reclamation Council. 436 p. [15460]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range and Habitat in Illinois

The non-native White Clover is a common plant that occurs in every county of Illinois. It was introduced into the United States from Europe a long time ago as a source of forage and hay. Habitats include pastures, fields, grassy meadows, lawns, parks, mowed areas along roadsides, paths through woodlands, and waste areas. This plant prefers disturbed areas that are grassy and subject to occasional mowing or grazing. In more natural areas, it is not tall enough to be very competitive with the native vegetation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA
HI ID IL IN IA KS KY LA ME MD
MA MI MN MS MO MT NE NV NH NJ
NM NY NC ND OH OK OR PA RI SC
SD TN TX UT VT VA WA WV WI WY
AB BC MB NT NS ON PQ SK YT

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Nile region (Cairo) and Mediterranean region (Alexandria).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Mediterranean region, Europe, west and central  Asia.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Localities documented in Tropicos sources

Trifolium repens L.:
Argentina (South America)
Brazil (South America)
Canada (North America)
Chile (South America)
China (Asia)
Colombia (South America)
Costa Rica (Mesoamerica)
Ecuador (South America)
Peru (South America)
Guatemala (Mesoamerica)
United States (North America)
Panama (Mesoamerica)
Caribbean (Caribbean)
Venezuela (South America)
Mexico (Mesoamerica)
Sri Lanka (Asia)
Honduras (Mesoamerica)
Greenland (North America)
Uruguay (South America)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Worldwide distribution

Native of Europe, N and W Asia and N Africa; widely naturalised elsewhere.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Mark Hyde, Bart Wursten and Petra Ballings

Source: Flora of Zimbabwe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Unknown/Undetermined

Confidence: Confident

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Unknown/Undetermined

Confidence: Confident

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution and adaptation

White clover thrives best in a cool, moist climate in soils with ample lime, phosphate, and potash. In general, white clover is best adapted to clay and silt soils in humid and irrigated areas. It grows successfully on sandy soils with a high water table or irrigated droughty soils when adequately fertilized. White clover seldom roots deeper than 2 feet, which makes it adapted to shallow soils when adequate moisture is available.

White clover is distributed throughout the United States. For a current distribution map, please consult the Plant Profile page for this species on the PLANTS Website.

Public Domain

USDA NRCS Plant Materials Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution: Pakistan; Kashmir; India; Russia, Central Asia, Siberia, Afghanistan; Caucasus; N.Africa; naturalized in N.America, Atlantic Islands; S. Africa; Australia and E.Asia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Physical Description

Morphology

Description

More info for the terms: cool-season, forb, stolon

White clover is a cool-season perennial forb. It produces stolons that
root at the nodes. The leaves are located along the creeping stems.
The small seeds have a hard seed coat [11,32,40].

A tap root develops in young plants and persists from less than 1 year
to 2 years. The majority of the roots are shallow and fibrous, forming
at stolon nodes [1]. Most of the roots of white clover are in the top 4
to 10 inches (10-25 cm) of the soil [1]. Some roots occur as deep as 24
inches (60 cm). Roots of at least one cultivar can penetrate up to 5
feet (1.5 m), depending on soil texture and structure [40].

Harberd [42] reported that most white clover clones live about 20 years,
but some may live to 100 or more years of age.
  • 1. Aldrich, D. T. A.; Anslow, R. C.; Boyce, R.; [and others]
  • 11. Gibson, P. B.; Cope, W. A. 1985. White clover. In: Clover science and technology. Agronomy Monograph No. 25. Madison, WI: Soil Science Society of America. 25: 471-490. [22366]
  • 32. Stubbendiek, James; Conard, Elverne C. 1989. Common legumes of the Great Plains: an illustrated guide. Lincoln, NE: University of Nebraska Press. 330 p. [11049]
  • 40. Wheeler, W. A.; Hill, D. D. 1957. Grassland seeds. Princeton, NJ: D. Van Nostrand Company, Inc. 628 p. [18902]
  • 42. Harberd, D. J. 1963. Observations on natural clones of Trifolium repens L. New Phytology. 62: 198-204. [22500]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Glabrous to glabrescent perennial, prostrate, rooting at nodes. Leaflets 1-4 cm long, broadly obovate, rounded or retuse at the apex; petiole long; stipules broad at the base, sheathing, ending in a subulate apex. Inflorescence a globose raceme, 15-25 mm broad. Flowers scented. Calyx 2-6 mm, 10-nerved, teeth unequal. Corolla white or pinkish. Vexillum 8-13 mm long. Fruit linear, 3-4-seeded.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Perennial, Herbs, Taproot present, Nodules present, Plants stoloniferous, Stems or branches arching, spreading or decumbent, Stems prostrate, trailing, or mat forming, Stems less than 1 m tall, Stems solid, Stems or young twigs glabrous or sparsely glabrate, Stems or young twigs sparsely to densely hairy, Leaves alternate, Leaves petiolate, Stipules conspicuous, Stipules membranous or chartaceous, Stipules persistent, Stipules clasping stem at the base, Stipules adnate to petiole, Leaves compound, Leaves palmately 2-3 foliate, Leaflets dentate or denticulate, Leaflets 3, Leaves glabrous or nearly so, Inflorescence s racemes, Inflorescence umbel-like or subumbellate, Inflorescences globose heads, capitate or subcapitate, Inflorescence axillary, Bracteoles present, Flowers zygomorphic, Calyx 5-lobed, Calyx glabrous, Petals separate, Corolla papilionaceous, Petals clawed, Petals white, Petals pinkish to rose, Banner petal narrow or oblanceolate, Wing petals narrow, oblanceolate to oblong, Wing petals auriculate, Wing tips obtuse or rounded, Keel tips obtuse or rounded, not beaked, Stamens 9-10, Stamens diadelphous, 9 united, 1 free, Filaments glabrous, Style terete, Fruit a legume, Fruit unilocular, Fruit indehiscent, Fruit oblong or ellipsoidal, Fruit orbicular to subglobose, Fruit or valves persistent on stem, Fruit glabrous or glabrate, Fruit 3-10 seeded, Seeds cordiform, mit-shaped, notched at one end, Seed surface smooth, Seeds olive, brown, or black.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Dr. David Bogler

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Elevation Range

1500-2500 m
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Key Plant Community Associations

White clover is an introduced species and is therefore not used in
habitat typing. It has, however, naturalized across North America is
often a major understory species in aspen (Populus tremuloides)
communities in the West [30].
  • 30. Severson, Kieth E.; Thilenius, John F. 1976. Classification of quaking aspen stands in the Black Hills and Bear Lodge Mountains. Res. Pap. RM-166. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 24 p. [2111]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the term: cover

White clover occurs in most SAF Cover Types.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

White clover occurs in most Kuchler Plant Associations.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat characteristics

White clover can grow in a wide range of soil and moisture conditions
but grows best in the humid areas of the temperate zone [39]. It is
found along roads, in meadows, and in wooded areas [12]. White clover
grows on well drained or poorly drained soils but optimal growth occurs
on moist, deep soils with 0 to 8 percent slope. It is not tolerant of
drought, excess water, or soils that are saline, highly alkaline, or
acid [11].
  • 11. Gibson, P. B.; Cope, W. A. 1985. White clover. In: Clover science and technology. Agronomy Monograph No. 25. Madison, WI: Soil Science Society of America. 25: 471-490. [22366]
  • 12. Gleason, Henry A.; Cronquist, Arthur. 1991. Manual of vascular plants of northeastern United States and adjacent Canada. 2nd ed. New York: New York Botanical Garden. 910 p. [20329]
  • 39. Watson, L. E.; Parker, R. W.; Polster, D. F. 1980. Manual of plant species suitablity for reclamation in Alberta. Vol. 2. Forbs, shrubs and trees. Edmonton, AB: Land Conservation and Reclamation Council. 537 p. [8855]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

White clover occurs in most ecosystems.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range and Habitat in Illinois

The non-native White Clover is a common plant that occurs in every county of Illinois. It was introduced into the United States from Europe a long time ago as a source of forage and hay. Habitats include pastures, fields, grassy meadows, lawns, parks, mowed areas along roadsides, paths through woodlands, and waste areas. This plant prefers disturbed areas that are grassy and subject to occasional mowing or grazing. In more natural areas, it is not tall enough to be very competitive with the native vegetation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dispersal

Establishment

The standard seeding rate is two pounds per acre. For pasture establishment, seeds are drilled into a well-prepared seedbed that has been plowed, harrowed, and compacted to produce a firm seedbed. The seeds are inoculated before seeding. For stabilization use, seeds are broadcast on roadside cuts and fills by cyclone seeders, hydroseeders, or blower-type equipment.

The proper time of seeding is determined by seasonal and moisture conditions. This may vary from April to May. Late summer and fall seedings should be conducted while adequate moisture is still in the soil to assure establishment before freezing.

Public Domain

USDA NRCS Plant Materials Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Faunal Associations

Primarily long-tongued bees visit the flowerheads to collect pollen or suck nectar, including bumblebees, honeybees, Mason bees, and Cuckoo bees (Epeoline and Nomadine). Other insect visitors include bee flies, Thick-headed flies, White butterflies, and skippers. The butterflies and skippers are not effective pollinators of clover flowers, however. Because White Clover is an important forage crop and is used in lawns, the insects feeding on the foliage or flowerheads are rather well known. The caterpillars of the butterflies Everes comyntas (Eastern Tailed-Blue), Colias cesonia (Dog-Faced Sulfur), Colias eurytheme (Orange Sulfur), and Colias philodice (Clouded Sulfur) use clovers as a food source. The White Clover is a preferred food source for the caterpillars of the Clouded Sulfur. The caterpillars of many moths feed on clovers (see Moth Table), as does Frankliniella trities (Flower Thrip). The foliage and seedheads are eaten by such upland gamebirds as the Ruffed Grouse, Greater Prairie Chicken, Wild Turkey, and Ring-Necked Pheasant. Some songbirds occasionally eat the seeds, including the Horned Lark and Smith Longspur (winter only). Various small mammals find the foliage and seedpods very attractive as a source of food, including the Cottontail Rabbit, Groundhog, Thirteen-Lined Ground Squirrel, and Meadow Vole. Large hoofed animals, such as the White-Tailed Deer, cattle, horses, and sheep, also graze on the foliage of clovers. If it is eaten in large amounts, however, White Clover can be toxic because it contains a glycoside that converts to prussic acid when the foliage is eaten by animals. However, cultivated strains of White Clover have been developed that are without this glycoside. The ecological value of White Clover to wildlife is high. It is also an important source of honey to humans.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Flower-Visiting Insects of White Clover in Illinois

Trifolium repens (White Clover) introduced
(Bees suck nectar or collect pollen, while other insects suck nectar; according to Robertson, butterflies, skippers, & moths are non-pollinating; individual observations are from Krombein et al. and Lewis as indicated below, otherwise observations are from Robertson)

Bees (long-tongued)
Apidae (Apinae): Apis mellifera sn fq; Apidae (Bombini): Bombus bimaculatus sn cp, Bombus griseocallis sn cp, Bombus impatiens sn, Bombus pensylvanica sn cp, Psithyrus variabilis sn; Anthophoridae (Anthophorini): Anthophora abrupta sn, Anthophora ursina sn cp; Anthophoridae (Ceratinini): Ceratina dupla dupla sn cp; Anthophoridae (Epeolini): Epeolus bifasciatus sn, Epeolus interruptus sn, Triepeolus remigatus sn; Anthophoridae (Eucerini): Synhalonia rosae sn, Synhalonia speciosa sn; Anthophoridae (Nomadini): Nomada affabilis sn fq, Nomada articulata sn, Nomada superba superba sn fq; Megachilidae (Anthidinini): Anthidium psoraleae sn cp fq; Megachilidae (Coelioxini): Coelioxys octodentata sn fq, Coelioxys sayi sn fq; Megachilidae (Megachilini): Megachile brevis brevis sn cp fq, Megachile centuncularis sn, Megachile mendica sn, Megachile texana sn; Megachilidae (Osmiini): Hoplitis cylindricus sn cp fq, Hoplitis pilosifrons sn cp fq, Osmia atriventris sn cp fq, Osmia collinsiae sn cp, Osmia conjuncta sn cp fq, Osmia cordata sn, Osmia distincta sn cp, Osmia pumila sn cp fq; Megachilidae (Trypetini): Heriades variolosa variolosa sn

Bees (short-tongued)
Halictidae (Halictinae): Agapostemon sericea sn cp fq, Agapostemon virescens sn cp, Augochlorella aurata sn, Augochlorella striata sn fq, Augochloropsis metallica metallica sn, Halictus confusus sn cp fq, Halictus ligatus sn cp, Halictus parallelus sn cp, Halictus rubicunda sn cp fq, Lasioglossum coriaceus sn cp fq, Lasioglossum pilosus pilosus sn cp, Lasioglossum versatus sn cp; Andrenidae (Andreninae): Andrena crataegi (Kr), Andrena cressonii sn cp; Andrenidae (Panurginae): Calliopsis andreniformis sn cp fq

Wasps
Sphecidae (Bembicnae): Microbombex monodonta; Sphecidae (Sphecinae): Ammophila nigricans, Ammophila pictipennis, Ammophila procera, Prionyx atrata; Scoliidae: Campsomeris plumipes

Flies
Empididae: Empis clausa; Bombyliidae: Bombylius atriceps, Parabombylius coquilletti, Systoechus vulgaris; Conopidae: Physocephala texana, Physocephala tibialis, Stylogaster biannulata, Zodion fulvifrons; Tachinidae: Archytas analis

Butterflies
Nymphalidae: Chlosyne nycteis, Euptoieta claudia, Vanessa virginiensis; Lycaenidae: Celastrina argiolus, Everes comyntas; Papilionidae: Papilio marcellus; Pieridae: Colias philodice, Pieris rapae (Rb, Lw), Pontia protodice

Skippers
Hesperiidae: Ancyloxypha numitor, Epargyreus clarus, Erynnis juvenalis, Pholisora catullus, Polites peckius, Polites themistocles fq, Thorybes pylades

Moths
Noctuidae: Anagrapha falcifera

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Foodplant / gall
larva of Apion curtisi causes gall of rootstock of Trifolium repens
Remarks: Other: uncertain

Foodplant / internal feeder
larva of Apion fulvipes feeds within inflorescence of Trifolium repens
Other: major host/prey

Foodplant / gall
larva of Apion laevicolle causes gall of Trifolium repens

Foodplant / internal feeder
larva of Apion virens feeds within stem of Trifolium repens
Other: major host/prey

In Great Britain and/or Ireland:
Foodplant / feeds on
pycnidium of Ascochyta coelomycetous anamorph of Ascochyta imperfecta feeds on live stem of Trifolium repens

Foodplant / sap sucker
adult of Berytinus minor sucks sap of Trifolium repens
Other: major host/prey

Plant / associate
adult of Bruchidius varius is associated with Trifolium repens
Remarks: season: (late 7-early 10, late 4)5-6

Foodplant / spot causer
amphigenous colony of Cercospora dematiaceous anamorph of Cercospora zebrina causes spots on live leaf of Trifolium repens
Remarks: season: 7-9

Foodplant / sap sucker
nymph of Chlamydatus pullus sucks sap of Trifolium repens
Remarks: Other: uncertain

Foodplant / sap sucker
nymph of Chlamydatus saltitans sucks sap of Trifolium repens
Remarks: Other: uncertain

Foodplant / parasite
stromatic Polythrinium dematiaceous anamorph of Cymadothea trifolii parasitises live leaf of Trifolium repens
Remarks: season: 7-10

Foodplant / parasite
conidial anamorph of Erysiphe trifolii parasitises live Trifolium repens

Foodplant / open feeder
larva of Hypera meles grazes on leaf of Trifolium repens
Other: major host/prey

Foodplant / open feeder
larva of Hypera punctata grazes on leaf of Trifolium repens
Other: major host/prey

Foodplant / spot causer
amphigenous, immersed, roundish, bright blackish-brown pycnidium of Stagonospora coelomycetous anamorph of Leptosphaeria pratensis causes spots on live leaf of Trifolium repens
Remarks: season: 6-9

Foodplant / spot causer
immersed pseudothecium of Leptosphaerulina trifolii causes spots on live leaf of Trifolium repens

Foodplant / miner
larva of Liriomyza congesta mines leaf of Trifolium repens
Other: major host/prey

Foodplant / feeds on
larva of Meligethes nigrescens feeds on Trifolium repens

Foodplant / nest
female of Melitta leporina provisions nest with pollen of Trifolium repens
Other: major host/prey

Foodplant / parasite
sporangium of Peronospora trifoliorum parasitises live Trifolium repens
Other: major host/prey

Foodplant / parasite
erumpent apothecium of Pseudopeziza trifolii parasitises live leaf of Trifolium repens
Remarks: season: 4-1

Foodplant / spot causer
mostly hypophyllous colony of Ramularia anamorph of Ramularia sphaeroidea causes spots on leaf of Trifolium repens

Foodplant / pathogen
apothecial Botrytis dematiaceous anamorph of Sclerotinia spermophila infects and damages buried, mummified seed of Trifolium repens

Plant / resting place / among
apothecium of Sclerotinia trifoliorum may be found among Trifolium repens
Remarks: season: 9-11

Foodplant / feeds on
larva of Sitona lepidus feeds on Trifolium repens
Other: major host/prey

Foodplant / feeds on
larva of Sitona lineellus feeds on Trifolium repens
Other: major host/prey

Foodplant / feeds on
larva of Sitona puncticollis feeds on Trifolium repens
Other: major host/prey

Foodplant / open feeder
nocturnal larva of Tenthredo arcuata grazes on leaf of Trifolium repens
Other: sole host/prey

Foodplant / open feeder
nocturnal larva of Tenthredo notha grazes on leaf of Trifolium repens

Foodplant / gall
often confluent telium of Uromyces trifolii causes gall of live petiole of Trifolium repens

Foodplant / parasite
uredium of Uromyces trifolii-repentis parasitises live stem of Trifolium repens

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Frequency

Frequent in the E Highlands, local elsewhere
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Mark Hyde, Bart Wursten and Petra Ballings

Source: Flora of Zimbabwe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Plant Response to Fire

More info for the term: frequency

Very little information about how white clover responds to fire was
given in the literature. Following mid-May precribed burning of a
Wisconsin oldfield being reclaimed to bluestem (Andropogon spp.)
prairie, white clover frequency was 4 percent. Frequency was 1 percent
on control and 6 percent on mowed plots [43]. Johnson [19] reported
that white clover seeds germinated on both burned and unburned plots in
central Iowa. After white clover was planted on the Sleeping Child Burn
in western Montana, it was present in postfire year 3 but was not
present in successional years [24].
  • 19. Johnson, Louise Adele. 1987. The effect of fires at different times of the year vegetative and sexual reproduction of grasses, and on establishment of seedlings. Ames, IA: Iowa State University. 91 p. Thesis. [20303]
  • 24. Lyon, L. Jack. 1976. Vegetal development on the Sleeping Child burn in western Montana, 1961 to 1973. Res. Pap. INT-184. Ogden, UT: U.S. Department of Agriculture, Forest Service Intermountain Forest and Range Experiment Station. 24 p. [138]
  • 43. Diboll, Neil. 1986. Mowing as an alternative to spring burning for control of cool season exotic grasses in prairie grass plantings. In: Clambey, Gary K.; Pemble, Richard H., eds. The prairie: past, present and future: Proceedings, 9th North American prairie conference; 1984 July 29 - August 1; Moorhead, MN. Fargo, ND: Tri-College University Center for Environmental Studies: 204-209. [3574]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Broad-scale Impacts of Fire

More info for the terms: competition, cover

Where fire enhances grass cover, the increase competition may reduce
cover of white clover further.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Immediate Effect of Fire

The stolons of white clover are killed by fire. If fire occurs in a
young population, where taproots are still vigorous, plants may
resprout, although probably with reduced vigor.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Post-fire Regeneration

More info for the terms: caudex, root crown

Ground residual colonizer (on-site, initial community)
Surface rhizome/chamaephytic root crown
Caudex, growing points in soil

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fire Ecology

More info for the term: caudex

Information regarding white clover survival following fire is lacking in
the literature. White clover is probably a decreaser following fire
since most of its growing parts are above ground and fire would quickly
defoliate these aboveground parts [3]. White clover probably
regenerates following fire via soil-stored seed. It may also sprout
from the taproot and/or caudex [19,23].
  • 3. Anderson, Roger C. 1972. The use of fire as a management tool on the Curtis Prairie. Arboretum News. Madison, WI: University of Wisconsin; 21(3): 1-9. [18377]
  • 19. Johnson, Louise Adele. 1987. The effect of fires at different times of the year vegetative and sexual reproduction of grasses, and on establishment of seedlings. Ames, IA: Iowa State University. 91 p. Thesis. [20303]
  • 23. Livingston, R. B.; Allessio, Mary L. 1968. Buried viable seed in successional field and forest stands, Harvard Forest, Massachusetts. Bulletin of the Torrey Botanical Club. 95(1): 58-69. [3377]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Successional Status

More info on this topic.

More info for the term: succession

Faculative Seral Species

White clover thrives in full sunlight and declines as grass cover
increases. It will grow in partial shade of aspen and oak woodlands
[38]. White clover rapidly invades canopy gaps [25]. In a study of
oldfield-deciduous forest succession in southwestern Ohio, white clover
was present on sites 2, 10, and 50 years after disturbance but not
present on sites that were 90 or more years old [35]. In British
Columbia, white clover is one of the first plants to colonize river
gravel bars [10].
  • 10. Garrison, George A.; Bjugstad, Ardell J.; Duncan, Don A.; [and others]
  • 25. Matlack, G. R.; Gibson, D. J.; Good, R. E. 1993. Clonal propagation, local disturbance, and the structure of vegetation: Ericaceous shrubs in the Pine Barrens of New Jersey. Biological Conservation. 63: 1-8. [20098]
  • 35. Vankat, John L.; Snyder, Gary W. 1991. Floristics of a chronosequence corresponding to old field - deciduous forest succession in southwestern Ohio. I. Undisturbed vegetation. Bulletin of the Torrey Botanical Club. 118(4): 365-376. [18759]
  • 38. Wasser, Clinton H. 1982. Ecology and culture of selected species useful in revegetating disturbed lands in the West. FWS/OBS-82/56. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 347 p. [4837]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regeneration Processes

White clover reproduces by seed and by stoloniferous stems [15]. The
seeds are dispersed by wind, water, birds, and grazing animals
[4,11,38]. Hull [17] reported that seeds stored for 25 years in
unheated sheds had a germination rate of 73 percent. In at least one
cultivar, the taproot supports vegetative regrowth [1].
  • 1. Aldrich, D. T. A.; Anslow, R. C.; Boyce, R.; [and others]
  • 4. Barrett, Juliana Panos; Silander, John A., Jr. 1992. Seedling recruitment limitation in white clover (Trifolium repens; Leguminosae). American Journal of Botany. 79(6): 643-649. [18733]
  • 11. Gibson, P. B.; Cope, W. A. 1985. White clover. In: Clover science and technology. Agronomy Monograph No. 25. Madison, WI: Soil Science Society of America. 25: 471-490. [22366]
  • 15. Hardy BBT Limited. 1989. Manual of plant species suitability for reclamation in Alberta. 2d ed. Report No. RRTAC 89-4. Edmonton, AB: Alberta Land Conservation and Reclamation Council. 436 p. [15460]
  • 17. Hull, A. C., Jr. 1973. Germination of range plant seeds after long periods of uncontrolled storage. Journal of Range Management. 26(3): 198-200. [18728]
  • 38. Wasser, Clinton H. 1982. Ecology and culture of selected species useful in revegetating disturbed lands in the West. FWS/OBS-82/56. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 347 p. [4837]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth Form (according to Raunkiær Life-form classification)

More info on this topic.

More info for the term: hemicryptophyte

Hemicryptophyte

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Form

More info for the term: forb

Forb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Phenology

More info on this topic.

White clover begins new growth in early to midspring, later in higher
elevations and latitudes. It flowers from May to July or throughout the
summer in cool, moist areas but becomes semidormant under hot, dry
conditions. The seeds mature about 3 to 4 weeks after flowering [36].
  • 36. Voth, Elver H.; Maser, Chris; Johnson, Murray L. 1983. Food habits of Arborimus albipes, the white-footed vole, in Oregon. Northwest Science. 57(1): 1-7. [9122]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Flower/Fruit

Fl.Per.: April-July.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Perennial.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Trifolium repens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGATATAGGGACTCTATATTTCATCTTCGGTGCCATTGCTGGAGTGATGGGCACATGCTTCTCAGTATTGATTCGTATGGAATTAGCACGACCCGGCGATCAAATTCTTGGTGGGAATCATCAACTTTATAATGTTTTAATAACGGCTCACGCTTTTTTAATGATCTTTTTTATGGTTATGCCGGCGATGATAGGTGGATCTGGTAATTGGTCTGTTCCGATTCTTATAGGTGCACCTGACATGGCATTTCCACGATTAAATAATATTTCATTCTGGTTGTTGCCGCCAAGTCTCTTGCTCCTATTAAGCTCAGCCTTAGTAGAGGTGGGTAGCGGCACTGGGTGGACGGTCTATCCGCCCTTAAGTGGTATTACCAGCCATTCTGGAGGAGCAGTTGATTCAGCAATTTCTAGTCTTCATCTATCTGGTGTTTCATCCATTTTAGGTTCTATCAATTTTATAACAACTATCTCCAACATGCGTGGACCTGGAATGACTATGCATAGATCACCCCTATTTGTGTGGTCCGTTCCAGTAACAGCATTCCCACTTTTATTATCACTTCCGGTACTGGCAGGCGCTATTACAATGTTATTAACCGATCGAAACTTTAATACAACCTTTTCTGATCCCGCAGGAGGGGGAGACCCCATA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Trifolium repens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 37
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Please consult the PLANTS Web site and your State Department of Natural Resources for this plant’s current status (e.g. threatened or endangered species, state noxious status, and wetland indicator values).

Public Domain

USDA NRCS Plant Materials Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Pests and potential problems

There are no serious pests of white clover; however, in the South, white clover is susceptible to a number of insect pests, as well as leaf and root diseases.

Public Domain

USDA NRCS Plant Materials Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management considerations

More info for the term: competition

White clover is normally used to provide a source of nitrogen for a sown
companion grass such as smooth brome (Bromus inermis), timothy (Phleum
pratense), or orchardgrass (Dactylis glomerata) while itself yielding
herbage rich in protein [1]. In southeastern United States rangelands,
grass forages grown with white clover average as high as or higher than
monospecific grass forage fertilized at nitrogen rates up to 300
pounds/acre (336 kg/ha). The inclusion of white clover also increases
the calcium concentration of the forage compared to grass alone.
Including a legume such as white clover in a forage mixture probably
offers more opportunity to increase forage nutritional yield than any
other practice generally available [28,38].

Spring mowing may decrease grass vigor and enhance growth of white
clover. Where midsummer mowing increases grass vigor, white clover
declines due to increased competition [1].
  • 1. Aldrich, D. T. A.; Anslow, R. C.; Boyce, R.; [and others]
  • 28. Rumbaugh, M. D. 1983. Legumes--their use in wildland plantings. In: Monsen, Stephen B.; Shaw, Nancy, compilers. Managing Intermountain rangelands--improvement of range and wildlife habitats: Proceedings of symposia; 1981 September 15-17; Twin Falls, ID; 1982 June 22-24; Elko, NV. Gen. Tech. Rep. INT-157. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Forest and Range Experiment Station: 115-122. [16104]
  • 38. Wasser, Clinton H. 1982. Ecology and culture of selected species useful in revegetating disturbed lands in the West. FWS/OBS-82/56. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 347 p. [4837]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Control

Please contact your local agricultural extension specialist or county weed specialist to learn what works best in your area and how to use it safely. Always read label and safety instructions for each control method. Trade names and control measures appear in this document only to provide specific information. USDA, NRCS does not guarantee or warranty the products and control methods named, and other products may be equally effective.

Public Domain

USDA NRCS Plant Materials Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cultivars, improved and selected materials (and area of origin)

The three general types of white clover usually recognized are (1) large, (2) intermediate, and (3) small.

Large type: ‘Ladino’ is the recommended cultivar of the large type. It is two to four times as large as common white clover. It is very well suited to the interior areas of western Oregon, away from the coast. It will winter kill under dry winter conditions, and is susceptible to slug damage. It requires a high soil phosphate level and good management for maximum production. ‘Pilgrim’ and ‘Merit’ have been developed for winter hardiness.

Intermediate type: ‘Grassland Huia’ is representative of the intermediate type. It was formerly designated ‘New Zealand’. It is very well adapted to locations along the coast and interior western Oregon where slugs are a problem.

Small type: “New York’ wild white clover is an example of the small type, which is adapted to higher elevations and colder areas. It is the most drought-resistant type. It is very persistent in pastures, withstands close grazing, and is the least productive of the white clovers. ‘Kent Wild’ white clover is also a small type.

White clover seeds are available at most commercial seed stores.

Public Domain

USDA NRCS Plant Materials Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management for forage is aimed at maintaining 40% to 50% clover. Close grazing (2 inch stubble height) favors clover, whereas light grazing favors grass. Well-fertilized grass will outgrow clover in fall and winter and could smother the clover.

Spring applications of nitrogen will stimulate grass and provide early feed, but excessive rates are detrimental to the clover stand. Phosphate applications are broadcast in fall or spring according to soil tests. Sulfur, boron, or magnesium may be needed for maximum production on some soils in the western part of white clover’s range.

Public Domain

USDA NRCS Plant Materials Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Weediness

This plant may become weedy or invasive in some regions or habitats and may displace desirable vegetation if not properly managed. Please consult with your local NRCS Field Office, Cooperative Extension Service office, or state natural resource or agriculture department regarding its status and use. Weed information is also available from the PLANTS Web site at plants.usda.gov.

Public Domain

USDA NRCS Plant Materials Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Value for rehabilitation of disturbed sites

More info for the term: reclamation

White clover is a common component of reclamation mixes in Canada and
the United States [15]. It is commonly used for corridor reclamation on
seismic lines and pipeline rights-of-way in Alberta. It has been
successfully used to revegetate acid coal mine wastes in New Brunswick.
White clover had good performance when seeded on disturbed sites above
5,500 feet (1,650 m) in southeastern British Columbia but gave poor
results when seeded on some alpine sites in Colorado. At other alpine
locations in Colorado, white clover was difficult to establish but
performed well on moist sites at 11,760 feet (3,530 m) elevation [39].
White clover is used on minespoils in the eastern United States to
provide plant diversity, especially in food patches or openings planted
for wildlife [36].

Because white clover is a nitrogen-fixing plant, it is often included in
grass mixtures or grass-forb mixtures [5,16].
  • 5. Bormann, Bernard T. 1988. A masterful scheme: Symbiotic nitrogen-fixing plants of the Pacific Northwest. University of Washington Arboretum Bulletin. 51(2): 10-14. [6796]
  • 15. Hardy BBT Limited. 1989. Manual of plant species suitability for reclamation in Alberta. 2d ed. Report No. RRTAC 89-4. Edmonton, AB: Alberta Land Conservation and Reclamation Council. 436 p. [15460]
  • 16. Helvey, J. D.; Fowler, W. B. 1979. Grass seeding and soil erosion in a steep, logged area in northeastern Oregon. PNW-343. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Forest and Range Experiment Station. 11 p. [7253]
  • 36. Voth, Elver H.; Maser, Chris; Johnson, Murray L. 1983. Food habits of Arborimus albipes, the white-footed vole, in Oregon. Northwest Science. 57(1): 1-7. [9122]
  • 39. Watson, L. E.; Parker, R. W.; Polster, D. F. 1980. Manual of plant species suitablity for reclamation in Alberta. Vol. 2. Forbs, shrubs and trees. Edmonton, AB: Land Conservation and Reclamation Council. 537 p. [8855]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cover Value

More info for the term: cover

The cover value for white clover has been rated as follows [7]:

UT WY MT ND
elk poor poor ---- ----
mule deer poor poor ---- ----
white-tailed deer ---- poor ---- ----
pronghorn poor ---- ---- ----
upland game birds poor ---- ---- ----
waterfowl poor ---- good good
small nongame birds poor ---- ---- ----
small mammals poor ---- ---- ----
  • 7. Dittberner, Phillip L.; Olson, Michael R. 1983. The plant information network (PIN) data base: Colorado, Montana, North Dakota, Utah, and Wyoming. FWS/OBS-83/86. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 786 p. [806]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance to Livestock and Wildlife

White clover is an excellent forage plant for livestock and wildlife
[15,20]. The leaves and flowers are grazed by grizzly bear, moose,
mule, white-tailed deer, and blue grouse [2,18,21,26]. It comprises
nearly 6 percent of the annual forage of the white-footed vole [37].
The seeds are eaten by the northern bobwhite, bufflehead, American coot,
sage grouse, ruffed grouse, sharp-tailed grouse, horned lark, mallard,
gray partridge, greater prairie chicken, willow ptarmigan, American
pintail, California quail, and American robin [13].
  • 2. Almack, Jon. 1986. Grizzly bear habitat use, food habits, and movements in the Selkirk Mountains, northern Idaho. In: Contreras, Glen P.; Evans, Keith E., compilers. Proceedings--grizzly bear habitat symposium; 1985 April 30 - May 2; Missoula, MT. Gen. Tech. Rep. INT-207. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station: 150-157. [10815]
  • 13. Graham, Edward H. 1941. Legumes for erosion control and wildlife. Misc. Publ. 412. Washington, DC: U.S. Department of Agriculture. 153 p. [10234]
  • 15. Hardy BBT Limited. 1989. Manual of plant species suitability for reclamation in Alberta. 2d ed. Report No. RRTAC 89-4. Edmonton, AB: Alberta Land Conservation and Reclamation Council. 436 p. [15460]
  • 18. Irwin, Larry L. 1985. Foods of moose, Alces alces, and white-tailed deer, Odocoileus virginianus, on a burn in boreal forest. Canadian Field-Naturalist. 99(2): 240-245. [4513]
  • 20. Kauffman, J. Boone; Krueger, W. C.; Vavra, M. 1983. Effects of late season cattle grazing on riparian plant communities. Journal of Range Management. 36(6): 685-691. [16965]
  • 21. King, R. Dennis; Bendell, James F. 1982. Foods selected by blue grouse (Dendragapus obscurus fuliginosus). Canadian Journal of Zoology. 60(12): 3268-3281. [10169]
  • 26. Olson, Rich. 1992. Mule deer habitat requirements and management in Wyoming. B-965. Laramie, WY: University of Wyoming, Cooperative Extension Service. 15 p. [20679]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cultivation

The preference is full or partial sun, mesic conditions, and a soil consisting of loam or clay loam. This plant fixes nitrogen into the soil.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nutritional Value

White clover is highly nutritious to cattle [15]. The leaves are
high-quality feed, and, on a dry-weight basis are high in protein and
carbohydrates [6,11].
  • 6. Cook, C. Wayne. 1966. Carbohydrate reserves in plants. Utah Research Series No. 31. [Place of publication unknown]
  • 11. Gibson, P. B.; Cope, W. A. 1985. White clover. In: Clover science and technology. Agronomy Monograph No. 25. Madison, WI: Soil Science Society of America. 25: 471-490. [22366]
  • 15. Hardy BBT Limited. 1989. Manual of plant species suitability for reclamation in Alberta. 2d ed. Report No. RRTAC 89-4. Edmonton, AB: Alberta Land Conservation and Reclamation Council. 436 p. [15460]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Palatability

Palatability ratings for white clover are as follows [7]:

UT CO WY MT ND
cattle good good good good good
sheep good good good good good
horses good good fair good good
  • 7. Dittberner, Phillip L.; Olson, Michael R. 1983. The plant information network (PIN) data base: Colorado, Montana, North Dakota, Utah, and Wyoming. FWS/OBS-83/86. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 786 p. [806]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Other uses and values

White clover is used extensively by bees to produce honey [33].
  • 33. Stubbendieck, James; Nichols, James T.; Butterfield, Charles H. 1989. Nebraska range and pasture forbs and shrubs (including succulent plants). Extension Circular 89-118. Lincoln, NE: University of Nebraska, Nebraska Cooperative Extension. 153 p. [10168]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Uses

Forage: White clover is the most important pasture legume. It is highly palatable, nutritious forage for all classes of livestock. White clover is commonly planted with orchardgrass, ryegrass, or tall fescue. ‘Ladino’ planted with orchardgrass produces the premier forage combination for intensive grazing systems in the Northeast. ‘Ladino’ grows tall enough to be harvested for hay, silage, and green chop. Common white clover seldom grows tall enough to be harvested for hay or silage.

Beautification: White clover is seeded at 2 pounds per acre with grass for stabilization on moist soils. On dry sites it usually establishes only on wet or moist areas.

Wildlife: White clover is a choice food for deer and elk.

Erosion control: Grass seedings benefit from the nitrogen produced by white clover included in the seed mixture. Solid stands of white clover form a good erosion controlling cover on moist fertile soils, but stands may be sparse or spotty on dry sites.

Public Domain

USDA NRCS Plant Materials Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Trifolium repens

Trifolium repens, the white clover (also known as Dutch clover), is a species of clover native to Europe, North Africa, and West Asia. It has been widely introduced worldwide as a pasture crop, and is now also common in most grassy areas of North America and New Zealand. White clovers are part of the pea family Fabaceae.

Contents

Name

The genus name, Trifolium, derives from the Latin tres, "three", and folium, "leaf", so called from the characteristic form of the leaf, which has three leaflets (trifoliate); hence the popular name trefoil.

The species name, repens, is Latin for "creeping".

Growth

It is a herbaceous, perennial plant. It is low growing, with heads of whitish flowers, often with a tinge of pink or cream that may come on with the aging of the plant. The heads are generally 1.5–2 cm wide, and are at the end of 7 cm peduncles or flower stalks.[1] The leaves, which by themselves form the symbol known as shamrock, are trifoliolate, smooth, elliptic to egg-shaped and long-petioled. The stems function as stolons, so white clover often forms mats, with the stems creeping as much as 18 cm a year, and rooting at the nodes.[1]

Cultivation and uses

Companion planting

White clover grows among turfgrass, crops, and in a large number of other landscapes.[1] It is also found in a limited range of different field type environments. White clover can tolerate close mowing, and can grow on many different types and pHs of soil, but prefers clay.[1] It is considered to be a beneficial component of natural or organic lawn care due to its ability to fix nitrogen and out-compete lawn weeds. Natural nitrogen fixing reduces leaching from the soil and can reduce the incidence of some lawn diseases that are enhanced by the availability of synthetic fertilizer.[2]

Culinary uses

White clover with four leaves

Besides making an excellent forage crop for livestock, clovers are a valuable survival food: they are high in proteins, widespread, and abundant. The fresh plants have been used for centuries as additives to salads and other meals consisting of leafy vegetables.

They are not easy for humans to digest raw, however, but this is easily fixed by boiling the harvested plants for 5–10 minutes.[3] Dried flowerheads and seedpods can also be ground up into a nutritious flour and mixed with other foods, or can be steeped into a tisane. White clover flour is sometimes sprinkled onto cooked foods such as boiled rice.

When used in soups, the leaves are often harvested before the plant produces flowers. The roots are also edible, although they are most often cooked firsthand.

Traditional medicine

White clover has been used as minor folk medicine by the Cherokee, Iroquois, Mohegan and other Native American tribes for centuries.[vague]

The Cherokee, for instance, used an infusion of the plant to treat fevers as well as Bright's disease. The Delaware and Algonkian natives used the same infusion, but as a treatment for coughing and the common cold.[citation needed]

As an invasive weed

Before the introduction of broad-leaf herbicides, white clover was more often added to lawn seed mixes than it is today, as it is able to grow and provide green cover in poorer soils where turfgrasses do not perform well. Many people consider clover a weed when growing in lawns, in part because the flowers are attractive to bees and thus could create a danger for people with bare feet.

White clover is the only known plant on which the caterpillars of the Coleophoridae case-bearer moth Coleophora mayrella feed.[citation needed]

In Britain, a high abundance of white clover is generally associated with species-poor, agriculturally improved grassland habitats, as it outcompetes the more rare plants and grasses especially in fertile soils, and has often been added as part of reseeding. Agri-environment schemes, such as the Countryside Stewardship Scheme, Environmentally Sensitive Areas Scheme, and Environmental Stewardship, give funding to species-rich grasslands that are relatively infertile and do not generally have an abundance of white clover. However, white clover does have value as a pollen and nectar source particularly in intensively farmed areas or amenity grasslands where there are few other flowers, and it can be found naturally at low levels in species-rich grasslands.[citation needed].

References

  1. ^ a b c d Richard H. Uva, Joseph C. Neal and Joseph M. Ditomaso, Weeds of The Northeast, (Ithaca, NY: Cornell University Press, 1997), Pp. 236-237.
  2. ^ The Organic Lawn Care Manual, Tukey, Storey Publishing. p 183.
  3. ^ Lee Allen Peterson, Edible Wild Plants, (New York City: Houghton Mifflin Company, 1977), P. 56.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Notes

Comments

Extensively cultivated as an important fodder plant.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!