Articles on this page are available in 2 other languages: Arabic (24), Spanish (1) (learn more)

Overview

Comprehensive Description

Comments

Among the various Trifolium spp. (Clovers), Red Clover is fairly easy to identify because of its large pink flowerheads and the white chevrons on its leaflets. It is unusual among the clovers in having sessile leaflets at the base of the flowerheads. There is some variability in the hairiness of the foliage and the color of the flowers. The common name is somewhat misleading because the flowers are never a true red. On rare occasions, a compound leaf will produce 4 or more leaflets.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This perennial plant is ½–2' tall, branching occasionally. The hairy stems are sprawling or erect. The alternate compound leaves are trifoliate. The lower compound leaves have long hairy petioles, while the upper leaves have short petioles or they are sessile. The leaflets are up to 2' long and ¾' across. They are oval-ovate or slightly obovate; sometimes they are a little broader below the middle. Their margins are smooth and ciliate and their tips are blunt. Toward the middle of the upper surface of each leaflet, there is usually a chevron that is white or light green. The leaflets are sessile and lack petioles of their own. At the base of each compound leaf, there is a pair of ovate stipules up to ½' long. The upper stems terminate in flowerheads that are spheroid or ovoid. Usually there are 1-3 leaflets immediately beneath each flowerhead, as well as several green bracts with tips that abruptly taper to a slender tip. Each flowerhead is about 1' across and consists of numerous flowers. These flowers are sessile, tubular-shaped, and spread outward in different directions. Each flower has 5 narrow petals that are pink or purplish pink, becoming light pink or white toward the base of the flowerhead; a rare form of this species with white petals also exists. The upper petal is slightly longer than the lower petals. The light green calyx of each flower has 5 slender teeth and it is usually hairy.  The blooming period usually occurs from late spring to mid-summer and lasts about 1-2 months. However, a few plants may bloom later in the summer or fall. The flowers have a mild honey-like fragrance, while the foliage, when it exists in abundance, produces a distinctive clover-like aroma that is quite pleasant. Each flower is replaced by a small seedpod containing 1 or 2 heart-shaped seeds. The root system consists of a taproot and produces rhizomes. This plant can spread vegetatively or by reseeding itself.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Trifolium pratense L., red clover, is an introduced biennial or short-lived perennial that grows as one of two types: medium (double-cut) or mammoth (single-cut). Red clover plants grow from crowns. Plants have hollow, hairy stems and branches. Stem lengths of medium and mammoth types average 18 inches and 24 to 30 inches, respectively. Medium types have about 4 branches per stem; mammoth have 6. Each leaf consists of a slender stalk bearing 3 leaflets. The taproot of red clover is extensively branched. Flowers are borne in compact clusters or heads and are usually rose-pink in color. Seed pods are small, short, and contain kidney-shaped seeds that vary in color from yellow to deep violet. Mammoth red clover matures later than medium types; only one crop of mammoth red clover is harvested each season since recovery is slow.

Public Domain

USDA NRCS Plant Materials Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range and Habitat in Illinois

The non-native Red Clover is a common plant that occurs in every county of Illinois (see Distribution Map). It was introduced from Eurasia as a fodder crop for farm animals and as a cover crop to improve agricultural soil. Habitats include fields, pastures, weedy meadows, vacant lots, grassy areas along roads, waste areas, and degraded prairie remnants. This plant occurs in native habitats occasionally, but it is only slightly to moderately aggressive. It is often found in grassy areas that are not subjected to regular mowing. Faunal Associations
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Localities documented in Tropicos sources

Trifolium pratense L.:
Argentina (South America)
Brazil (South America)
Canada (North America)
Chile (South America)
Colombia (South America)
Costa Rica (Mesoamerica)
Ecuador (South America)
Greenland (North America)
Guatemala (Mesoamerica)
Taiwan (Asia)
United States (North America)
Caribbean (Caribbean)
Bolivia (South America)
China (Asia)
Uruguay (South America)
Venezuela (South America)
Mexico (Mesoamerica)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Unknown/Undetermined

Confidence: Confident

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Unknown/Undetermined

Confidence: Confident

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution: Kashmir; Europe; Central and South Western Asia; Afghanistan; N.Africa, Canaries, introduced in N.America and other places.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nepal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution and adaptation

Red clover grows best on well-drained loamy soils, but it will also grow on soil that is not as well-drained. Medium and fine textured soils are preferred by the plant over sandy or gravelly soils. It is best adapted to a pH of 6.0 or higher.

Red clover is distributed throughout the United States. For a current distribution map, please consult the Plant Profile page for this species on the PLANTS Website.

Public Domain

USDA NRCS Plant Materials Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Description

Erect to decumbent perennial. Leaflets 1.5-3.0 cm long, obovate to broadly elliptic, obscurely dentate; stipules ovate-lanceolate, free portion abruptly mucronate. Inflorescence a head, 7-22 mm wide, globose to ovoid, sessile or rarely pedunculate, usually with an involucre of stipules or reduced bracts. Calyx pubescent, lowest tooth longer than others and the calyx cup. Corolla reddish-purple to pink, rarely whitish. Vexillum 13-18 mm long. Fruit 1-seeded, opening by a lid.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Perennial, Herbs, Taproot present, Nodules present, Stems erect or ascending, Stems less than 1 m tall, Stems solid, Stems or young twigs sparsely to densely hairy, Stems hairs pilose or spreading, Leaves alternate, Leaves petiolate, Stipules conspicuous, Stipules green, triangulate to lanceolate or foliaceous, Stipules persistent, Stipules clasping stem at the base, Stipules adnate to petiole, Leaves compound, Leaves palmately 2-3 foliate, Leaf or leaflet margins entire, Leaflets dentate or denticulate, Leaflets 3, Leaves glabrous or nearly so, Inflorescences racemes, Inflorescences globose heads, capitate or subcapitate, Inflorescence sessile or subsessile, Inflorescence axillary, Inflorescence terminal, Bracts conspicuously present, Bracteoles present, Flowers sessile or nearly so, Flowers zygomorphic, Calyx 5-lobed, Calyx hairy, Petals separate, Corolla papilionaceous, Petals clawed, Petals white, Petals pinkish to rose, Petals blue, lavander to pu rple, or violet, Banner petal narrow or oblanceolate, Wing petals narrow, oblanceolate to oblong, Wing petals auriculate, Wing tips obtuse or rounded, Keel tips obtuse or rounded, not beaked, Stamens 9-10, Stamens diadelphous, 9 united, 1 free, Filaments glabrous, Style terete, Fruit a legume, Fruit unilocular, Fruit freely dehiscent, Fruit indehiscent, Fruit oblong or ellipsoidal, Fruit orbicular to subglobose, Fruit or valves persistent on stem, Fruit enclosed in calyx, Fruit glabrous or glabrate, Fruit 1-seeded, Seeds cordiform, mit-shaped, notched at one end, Seed surface smooth, Seeds olive, brown, or black.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Dr. David Bogler

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Range and Habitat in Illinois

The non-native Red Clover is a common plant that occurs in every county of Illinois (see Distribution Map). It was introduced from Eurasia as a fodder crop for farm animals and as a cover crop to improve agricultural soil. Habitats include fields, pastures, weedy meadows, vacant lots, grassy areas along roads, waste areas, and degraded prairie remnants. This plant occurs in native habitats occasionally, but it is only slightly to moderately aggressive. It is often found in grassy areas that are not subjected to regular mowing. Faunal Associations
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dispersal

Establishment

Red clover may be seeded in pure stands, but it is often mixed with grain or grass. Spring or late summer seedings are satisfactory. It may be overseeded in the spring on fall seeded grasses. Red clover seed should be inoculated. Phosphorus and potash are the fertilizer elements needed mostly by red clover. Apply as recommended by soil tests. Seeding may be done with a drill or broadcast. A firm, weed-free seedbed is essential. Plant seeds ¼ to ½ inch deep.

Public Domain

USDA NRCS Plant Materials Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flower-Visiting Insects and Birds of Red Clover in Illinois

Trifolium pratense (Red Clover) introduced
(Bees suck nectar or collect pollen, while hummingbirds & other insects suck nectar; short-tongued bees, butterflies, skippers, & moths are non-pollinating according to Robertson; most observations are from Robertson, otherwise they are from Reed, Graenicher, Lewis, and Macior as indicated below)

Birds
Trochilidae: Archilochus colubris (Rb, Gr)

Bees (long-tongued)
Apidae (Bombini): Bombus auricomus sn (Rb, Mc), Bombus bimaculatus sn (Rb, Re), Bombus fervida sn fq (Mc), Bombus fraternus sn, Bombus griseocallis sn cp fq (Rb, Mc), Bombus impatiens sn (Rb, Mc), Bombus pensylvanica sn cp fq (Rb, Mc), Bombus vagans sn cp (Rb, Mc), Psithyrus citrinus sn, Psithyrus variabilis sn fq; Anthophoridae (Anthophorini): Anthophora abrupta sn, Anthophora ursina sn cp, Anthophora walshii sn; Anthophoridae (Eucerini): Melissodes bimaculata bimaculata sn, Synhalonia speciosa sn cp fq; Megachilidae (Anthidinini): Anthidium psoraleae sn cp fq; Megachilidae (Megachilini): Megachile brevis brevis sn cp; Megachilidae (Osmiini): Hoplitis pilosifrons sn, Osmia cordata sn cp

Bees (short-tongued)
Halictidae (Halictinae): Halictus rubicunda cp; Andrenidae (Panurginae): Calliopsis andreniformis cp

Flies
Bombyliidae: Exoprosopa fasciata

Butterflies
Nymphalidae: Danaus plexippus, Speyeria cybele, Vanessa atalanta, Vanessa cardui (Rb, Re), Vanessa virginiensis fq; Lycaenidae: Everes comyntas; Papilionidae: Battus philenor, Papilio cresphontes, Papilio marcellus, Papilio polyxenes asterias; Pieridae: Colias philodice, Eureme nicippe, Phoebis sennae, Pieris rapae (Rb, Lw), Pontia protodice

Skippers
Hesperiidae: Epargyreus clarus fq, Polites peckius, Polites themistocles, Thorybes pylades

Moths
Sphingidae: Hemaris diffinis

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Foodplant / feeds on
larva of Apion apricans feeds on inflorescence of Trifolium pratense
Other: sole host/prey

Foodplant / internal feeder
larva of Apion assimile feeds within inflorescence of Trifolium pratense
Other: major host/prey

Foodplant / feeds on
larva of Apion laevicolle feeds on Trifolium pratense
Other: major host/prey

Foodplant / internal feeder
larva of Apion trifolii feeds within inflorescence of Trifolium pratense

Foodplant / feeds on
larva of Apion varipes feeds on flower? of Trifolium pratense

Foodplant / internal feeder
larva of Apion virens feeds within stem of Trifolium pratense
Remarks: Other: uncertain

In Great Britain and/or Ireland:
Foodplant / spot causer
epiphyllous, few, immersed, brownish pycnidium of Ascochyta coelomycetous anamorph of Ascochyta trifolii causes spots on live leaf of Trifolium pratense
Remarks: season: 7

Foodplant / pathogen
Bean Yellow Mosaic virus infects and damages live Trifolium pratense

Foodplant / pathogen
conidiophore of Botrytis dematiaceous anamorph of Botrytis anthophila infects and damages greyed anther of Trifolium pratense

Plant / associate
adult of Bruchidius varius is associated with Trifolium pratense
Remarks: season: (late 7-early 10, late 4)5-6
Other: major host/prey

Foodplant / sap sucker
Ceraleptus lividus sucks sap of Trifolium pratense

Foodplant / parasite
conidial anamorph of Erysiphe trifolii parasitises live Trifolium pratense

Foodplant / open feeder
larva of Hypera meles grazes on leaf of Trifolium pratense
Other: major host/prey

Foodplant / open feeder
larva of Hypera nigrirostris grazes on leaf of Trifolium pratense
Other: major host/prey

Foodplant / open feeder
larva of Hypera punctata grazes on leaf of Trifolium pratense
Other: major host/prey

Foodplant / spot causer
erumpent Kabatiella coelomycetous anamorph of Kabatiella caulivora causes spots on live petiole of Trifolium pratense
Remarks: season: 4-7

Foodplant / spot causer
immersed pseudothecium of Leptosphaerulina trifolii causes spots on live leaf of Trifolium pratense

Foodplant / spot causer
amphigenous pseudothecium of Mycosphaerella carinthiaca causes spots on live leaf of Trifolium pratense
Remarks: season: 4-5

Foodplant / feeds on
adult of Orsodacne humeralis feeds on pollen? of Trifolium pratense
Remarks: season: 3-6

Foodplant / parasite
sporangium of Peronospora trifoliorum parasitises live Trifolium pratense
Other: major host/prey

Foodplant / saprobe
gregarious, sessile apothecium of Pseudombrophila ramosa is saprobic on dead, rotting stem of Trifolium pratense

Foodplant / parasite
erumpent apothecium of Pseudopeziza trifolii parasitises live leaf of Trifolium pratense
Remarks: season: 4-1

Foodplant / spot causer
mostly hypophyllous colony of Ramularia anamorph of Ramularia sphaeroidea causes spots on leaf of Trifolium pratense

Foodplant / saprobe
superficial colony of Sarcopodium dematiaceous anamorph of Sarcopodium circinatum is saprobic on dead stem of Trifolium pratense

Plant / resting place / among
apothecium of Sclerotinia trifoliorum may be found among Trifolium pratense
Remarks: season: 9-11

Foodplant / feeds on
larva of Sitona lepidus feeds on Trifolium pratense
Other: major host/prey

Foodplant / feeds on
larva of Sitona puncticollis feeds on Trifolium pratense
Other: major host/prey

Foodplant / feeds on
larva of Sitona sulcifrons feeds on Trifolium pratense
Other: major host/prey

Foodplant / spot causer
conidiophore of Stemphylium dematiaceous anamorph of Stemphylium sarciniforme causes spots on live leaf of Trifolium pratense

Foodplant / parasite
hypophyllous telium of Uromyces fallens parasitises live leaf of Trifolium pratense
Other: major host/prey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Flower/Fruit

Fl.Per.: July-August.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Trifolium pratense

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGATATAGGGACTCTATATTTCATCTTCGGTGCCATTGCTGGAGTGATGGGCACATGCTTCTCAGTATTGATTCGTATGGAATTAGCACGACCCGGCGATCAAATTCTTGGTGGGAATCATCAACTTTATAATGTTTTAATAACGGCTCACGCTTTTTTAATGATCTTTTTTATGGTTATGCCGGCGATGATAGGTGGATCTGGTAATTGGTCTGTTCCGATTCTTATAGGTGCACCTGACATGGCATTTCCACGATTAAATAATATTTCATTCTGGTTGTTGCCGCCAAGTCTCTTGCTCCTATTAAGCTCAGCCTTAGTAGAGGTGGGTAGCGGCACTGGGTGGACGGTCTATCCGCCCTTAAGTGGTATTACCAGCCATTCTGGAGGAGCAGTTGATTCAGCAATTTCTAGTCTTCATCTATCTGGTGTTTCATCCATTTTAGGTTCTATCAATTTTATAACAACTATCTCCAACATGCGTGGACCTGGAATGACTATGCATAGATCACCCCTATTTGTGTGGTCCGTTCCAGTAACAGCATTCCCACTTTTATTATCACTTCCGGTACTGGCAGGGGCAATTACAATGTTATTAACCGATCGAAACTTTAATACAACCTTTTCTGATCCCGCAGGAGGGGGAGACCCCATA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Trifolium pratense

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Please consult the PLANTS Web site and your State Department of Natural Resources for this plant’s current status (e.g. threatened or endangered species, state noxious status, and wetland indicator values).

Public Domain

USDA NRCS Plant Materials Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Pests and potential problems

Anthracnose and powdery mildew may be problems in areas with high humidity and rainfall. Choose resistant cultivars to reduce the occurrence of these diseases.

Public Domain

USDA NRCS Plant Materials Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Cultivars, improved and selected materials (and area of origin)

Some of the major cultivars for the western US are ‘Pennscott’, ‘Chesapeake’, ‘Kenland’, ‘Cumberland’, ‘Dollard’, ‘Midland’ and ‘Lakeland’. ‘Altaswede’, ‘Norlac’, and ‘Craig’ are mammoth red clovers. In the eastern US, varieties selected should be resistant to anthracnose and powdery mildew. Some cultivars commercially available that are moderate to highly resistant to anthracnose are ‘Acclaim’, ‘Rally’, ‘Redland II’, and ‘Renegade’. Those moderate to highly resistant to powdery mildew are ‘Arlington’, ‘Rally’, ‘Rebel’, ‘Red Star’, and ‘Reddy’. Most cultivars and varieties adapted to your area can be found through local seed suppliers.

Public Domain

USDA NRCS Plant Materials Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Graze or cut for hay when the red clover is ¼ to ½ in bloom. A second cutting or successive grazings should occur when red clover is ¼ in bloom. Leave at least 2 inches of growth after each harvest. Care should be taken to eliminate or appreciably reduce bloating of livestock. Keep lime and fertilizers (phosphorus and potash) at the proper level. Control insects and diseases.

Public Domain

USDA NRCS Plant Materials Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Cultivation

The preference is full sun, mesic conditions, and a loam or clay-loam soil. This plant adds nitrogen to the soil by forming root nodules that accommodate rhizobial bacteria. Partial sun is tolerated.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Uses

Red clover is primarily used for hay, pasture, silage, and soil improvement. It is a quick growing crop, easily established, and produces high quality forage. Tolerance of shade allows red clover to be used effectively as a cover crop under silage corn.

Public Domain

USDA NRCS Plant Materials Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Trifolium pratense

Trifolium pratense (red clover) is a species of clover, native to Europe, Western Asia and northwest Africa, but planted and naturalised in many other regions.

It is an herbaceous, short-lived perennial plant, variable in size, growing to 20–80 cm tall. The leaves are alternate, trifoliate (with three leaflets), each leaflet 15–30 mm long and 8–15 mm broad, green with a characteristic pale crescent in the outer half of the leaf; the petiole is 1–4 cm long, with two basal stipules. The flowers are dark pink with a paler base, 12–15 mm long, produced in a dense inflorescence.

Contents

Diseases [edit]

Red clover is subject to bacterial as well as fungal diseases. Other problems include parasitic nematodes (roundworms) and viruses.

Uses [edit]

Trifolium pratense, general aspect

It is widely grown as a fodder crop, valued for its nitrogen fixation, which increases soil fertility. For these reasons it is used as a green manure crop. Several cultivar groups have been selected for agricultural use, mostly derived from var. sativum. It has become naturalised in many temperate areas, including the Americas and Australasia as an escape from cultivation.

Red clover contains isoflavones (estrogen-like compounds) which can mimic the effect of endogenous estrogen. The use of red clover to relieve menopausal symptoms has been shown to be sometimes ineffective, but safe.[1] The isoflavones (like irilone and pratensein) from red clover have been used to treat the symptoms of menopause.[2] A large, well-controlled study of high-isoflavone red clover extract supplements showed a modest reduction of hot flashes with Promensil, but not Rimostil, compared to placebo.[3]

Traditionally, red clover has been administered[according to whom?] to help restore irregular menses and to balance the acid-alkaline level of the vagina to promote conception.[4]

Red clover has been reported by herbalist Jethro Kloss in his book, "Back to Eden", to be used for a variety of medicinal purposes, such as the treatment of bronchitis, burns, cancers, ulcers, sedation, asthma, syphilis, and quitting smoking.[5][unreliable source?][6]

Red clover is commonly used to make a sweet-tasting tisane.[7] It is an ingredient in eight-herb essiac tea.

Warnings and contraindications [edit]

Dietary amounts of red clover are safe, but medicinal quantities may cause rash-like reactions, muscle ache, headache, nausea, vaginal bleeding in women, and slow blood clotting.[8]

Due to its activity on estrogen receptors, red clover is contraindicated in people with a history of breast cancer, endometriosis, ovarian cancer, uterine cancer, uterine fibroids, or other estrogen-sensitive conditions,[9] but others have suggested the high isoflavone content counteracts this, and even provides benefits in these conditions.[10]

Due to its coumarin derivatives, it should be used in caution in individuals with coagulation disorders or currently undergoing anticoagulation therapy.[11]

It is metabolized by CYP3A4 and therefore caution should be used when taking it with other drugs using this metabolic pathway.[12]

Symbolism [edit]

It is the national flower of Denmark[13] and the state flower of Vermont.

See also [edit]

References [edit]

  1. ^ Geller SE, Shulman LP, van Breemen RB, et al. (2009). "Safety and efficacy of black cohosh and red clover for the management of vasomotor symptoms: a randomized controlled trial". Menopause (New York, N.Y.) 16 (6): 1156–66. doi:10.1097/gme.0b013e3181ace49b. PMC 2783540. PMID 19609225. 
  2. ^ "Red Clover Flowers Herbal Information". Indigo-herbs.co.uk. Retrieved 2012-08-05. 
  3. ^ Tice JA, Ettinger B, Ensrud K, Wallace R, Blackwell T, Cummings SR (2003). "Phytoestrogen supplements for the treatment of hot flashes: the Isoflavone Clover Extract (ICE) Study: a randomized controlled trial". Journal of the American Medical Association 290 (2): 207–214. PMID 12851275. 
  4. ^ "Natural Remedies That Can Help Increase Your Chances of Getting Pregnant". Babyhopes.com. Retrieved 2012-08-05. 
  5. ^ "Quit Tea Ingredients Herbs Best Stop Smoking Method | Quit Tea Natural Stop Smoking Aid". Quittea.com. Retrieved 2012-08-05. 
  6. ^ "Purdue Horticulture: ''T. pratense''". Hort.purdue.edu. 1998-01-09. Retrieved 2012-08-05. 
  7. ^ "Red Clover Tea". SupplementSOS.com. Retrieved 2013-03-09. 
  8. ^ Red clover, WebMD.
  9. ^ USA (2012-05-24). "Influence of marketed herbal menopause pre... [Menopause. 2004 May-Jun] - PubMed - NCBI". Ncbi.nlm.nih.gov. Retrieved 2012-08-05. 
  10. ^ Roberts DW et al. J Agric Food Chem. 2004 Oct:70(10);1003-5
  11. ^ USA (2012-05-24). "Herbal medication: potential for adverse i... [J Clin Pharm Ther. 2002] - PubMed - NCBI". Ncbi.nlm.nih.gov. Retrieved 2012-08-05. 
  12. ^ "red clover (Trifolium pratense) Cautions - Epocrates Online". Online.epocrates.com. Retrieved 2012-08-05. 
  13. ^ Other National Symbols - Embassy of Denmark India
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Notes

Comments

Widely cultivated as a fodder crop; quite variable.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!