Molecular Biology and Genetics

Molecular Biology

Barcode data: Nembrotha megalocera

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTATATGTTTTTTTAGGTATGTGATGTGGCTTGGTCGGGACAGGGCTAAGTTTACTAATTCGTTTTGAGCTAGGAACAGCAGGTGCTTTCTTAGGGGAT---GATCATTTTTATAATGTGATCGTTACTGCTCATGCATTTGTAATGATTTTTTTTATGGTGATGCCATTAATAATTGGAGGGTTTGGAAACTGAATGGTGCCATTATTAATTGGAGCTCCTGATATAAGTTTTCCCCGGATGAATAACATAAGATTTTGGTTGTTACCTCCTTCTTTTATTTTATTACTATGTTCAACCCTAATGGAGGGGGGAGCTGGAACTGGCTGAACTGTTTATCCTCCTTTGTCTGGTCCCGTTGCCCACGGTGGAGCTTCAGTAGATCTAGCAATTTTTTCTCTTCATTTAGCGGGGGCTTCTTCTTTGTTGGGGGCTATTAATTTTATTACTACTATTTTTAATATACGTTCTTCTGCTATAACAATGGAACGATTGAGACTATTTGTTTGATCAGTGTTGGTGACGGCTTTTTTATTATTACTATCATTACCGGTTCTAGCAGGAGCTATTACTATGTTATTAACTGATCGAAATTTTAATACAAGTTTTTTTGATCCTGCTGGTGGAGGAGACCCAATTTTGTATCAACACTTGTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Nembrotha megalocera

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Nembrotha megalocera

Nembrotha megalocera is a species of colourful sea slug, a dorid nudibranch, a marine gastropod mollusk in the family Polyceridae. It was first described in 1990.[2]

Distribution[edit]

This species is known from the Red Sea.

Description[edit]

Nembrotha megalocera is a large black and orange-yellow nembrothid that grows to at least 45 mm in length. It has a blue foot. The rhinophores are red and purple and the gill stalks are white and yellow.

Ecology[edit]

Nembrotha megalocera eats colonial ascidians.[3]

References[edit]

  1. ^ http://www.seaslugforum.net/find/nembmega
  2. ^ [1], Yonow, N. (1990) Red Sea Opisthobranchia 3: The orders Sacoglossa, Cephalaspidea, and Nudibranchia: Doridacea (Mollusca, Opisthobranchia). Fauna of Saudi Arabia, 11: 286-299.
  3. ^ http://www.seaslugforum.net/find/3748
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!