Articles on this page are available in 1 other language: Spanish (7) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Molothrus oryzivorus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACGTAATTTTCGGTGCATGAGCCGGAATGGTAGGTACCGCCCTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGATCAAGTATACAACGTAGTTGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATACCAATCATAATCGGAGGATTCGGAAACTGACTAGTACCTCTAATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTTCCCCCATCCTTCCTCCTCCTCCTAGCATCCTCCACGGTAGAGGCAGGCGTAGGCACAGGCTGAACAGTGTACCCCCCACTAGCAGGCAACCTAGCTCACGCCGGAGCCTCAGTCGACCTTGCAATTTTCTCACTACATCTAGCCGGTATCTCTTCAATCCTGGGAGCAATCAACTTCATCACAACAGCAGTCAACATAAAACCACCTGCCCTCTCACAATACCAAACCCCCCTATTCGTTTGATCCGTCCTAATCACTGCAGTACTATTACTTCTATCCCTCCCAGTCCTTGCCGCAGGAATTACAATGCTTCTCACAGACCGCAACCTTAACACCACATTCTTTGATCCTGCCGGAGGAGGAGACCCTGTACTATACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Molothrus oryzivorus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 5,000,000-50,000,000 individuals (A. Panjabi in litt. 2008).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Giant Cowbird

The giant cowbird (Molothrus oryzivorus) is a large passerine bird in the New World family Icteridae. It breeds from southern Mexico south to northern Argentina, and on Trinidad and Tobago. It may have relatively recently colonised the latter island.

It is associated with open woodland and cultivation with large trees, but is also the only cowbird that is found in deep forest. It is a quiet bird, particularly for an icterid, but the male has an unpleasant screeched whistle, shweeaa-tpic-tpic. The call is a sharp chek-chik. They are also very adept mimics.

Like other cowbirds, it is a brood parasite, laying its eggs in the nests of oropendolas and caciques. The eggs are of two types, either whitish and unspotted, or pale blue or green with dark spots and blotches. The host’s eggs and chicks are not destroyed, but there is considerable doubt about the theory that the young giant cowbirds benefit the host’s chick by removing and eating parasitic flies.

Their icterid hosts breed colonially, and defend their nests vigorously, so even a large, bold and aggressive species like the giant cowbird has to cover an extensive territory to find sufficient egg-laying opportunities. Several giant cowbird eggs may be laid in one host nest.

The male giant cowbird is 36 cm (14 in) long, weighs 180 g (6.3 oz) and is iridescent black, with a long tail, long bill, small head, and a neck ruff which is expanded in display. The female is smaller, averaging 28 cm (11 in) long and weighing 135 g (4.8 oz). She is less iridescent than the male, and the absence of the neck ruff makes her look less small-headed. Juvenile males are similar to the adult male, but browner, and with a pale, not black, bill.

This gregarious bird feeds mainly on insects, and some seeds, including rice, and forages on the ground or in trees. It rarely perches on cattle, unlike some of its relatives, but in Brazil it will ride on capybaras as it removes horse flies.[citation needed]

References[edit]

  • New World Blackbirds by Jaramillo and Burke, ISBN 0-7136-4333-1
  • ffrench, Richard (1991). A Guide to the Birds of Trinidad and Tobago (2nd edition ed.). Comstock Publishing. ISBN 0-8014-9792-2. 
  • Hilty, Steven L (2003). Birds of Venezuela. London: Christopher Helm. ISBN 0-7136-6418-5. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!