Overview

Brief Summary

Succinct

Adult White Pine Weevils are dark brown with lighter flecks, average 6 mm in length, and occur throughout North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Brian D. Farrell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Introduction

Adult white pine weevils are dark brown with lighter flecks and are the most destructive insects attacking white pine. Their larvae hatch from eggs laid in the terminal leader of the host tree, tunneling and feeding towards the base of the leader which is eventually killed. They also attack Sitka Spruce, Engelmann Spruce and White Spruce, and will attack other native and non-native species of pines and spruces.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Brian D. Farrell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Original Description

Transcribed by B. D. Farrell

Peck, W. D. 1817. On the insects that destroy the young branches of the Pear-tree, and the leading shoot of the Weymouth-Pine. Massachusetts Agricultural Journal 4(3): 205-211, 1 plate.

Plate I is opposite page 205, listing:

W. D. Peck, esq., Professor of Natural History and of Botany, Harvard University. On the insects that destroy the young branches of the Pear-tree, and the leading shoot of the Weymouth-Pine. Massachusetts. 1817. Agricultural Journal 4(3): 205-211, 1 plate.

On page 208:

“One of the most beautiful and the loftiest of the evergreens of New-England, is the Pinus Strobus, the White or Weymouth Pine. The straightness of its trunk is one of its beauties, as it brings to mind the recollection of its utility in masting and for other important purposes. It has been known to acquire the height of 140 or 150 feet, and a diameter of more than seven feet and a half at its base.

The lofty stature of this tree depends on the constant health of the leading shoot for a long succession of years. If the leading shoot is destroyed, the trunk can rise no higher, and although it may happen that in the circle of branches immediately below it, one more vigorous than the rest may be forced by those on each side it, into a more ascending direction, and become a kind of leading shoot; yet the tree is deformed.

It has been observed that in many of those which are cultivated in ornamented grounds and gardens, the leading shoot is destroyed. This is the work of insects, especially of a species of weevil. The species which is so injurious to the White Pine, is, I believe, pretty generally diffused over our country and is undescribed. I have seen it often and in many places, but knew not till the last years, the particular task assigned it in the economy of nature. It is a species of Rhychaenus of Fabricius, a genus which constituted a tribe of the Curculio of Linnaeusit; it is about 3/10 of an inch in length. The ground-colour of the shelly coat and legs is brown, and covered with brownish and rust-coloured scales, with white ones scattered among them, which give it a reddish grey or a kind of roan colour. The thorax is darker, the elytra more rust-coloured. The head is lengthened out into a horny proboscis, at the end of which the feeding apparatus is placed. These are shewn much magnified in plate 2, where a represent the mandibles as viewed on the inner side; they are externally rounded, internally marked with two excavations, the edge cut into three large bluntish teeth. bb, The maxillae torose or swollen toward the base, crowned with conical palpi (p p) of four joints; on the interior edge divided into about eight short, curved teeth and set with bristles; below these a tuft of strong bristles, which turn upward or toward the points of the maxillae. c, the ligula somewhat squared and terminated with two conical palpi (p) of three joints. There is no labium superius that I could perceive. The head with the snout is about as long as the thorax; the antennae of about the same length, the first joint is largest forming nearly half the length of the antennae, the other ten are shorter, the three last of these thicker, forming an oval knob each of these joints is fringed with short white scales. The eyes are small, lateral, at the base of the snout; the head is small and received by the thorax, which is narrowed to fit it. The thorax is then enlarged, but is not so broad as the back across the wing-cases: in the middle of the thorax are two small white dots, which form a triangle with a white spot behind them at the junction of the elytra. The elytra are striated or furrowed, but very lightly and are covered with small scales, pretty closely set, those of a rust-colour are the most numerous; the elytra are suddenly narrowed towards the ends; a little before this contraction is an irregular white blotch on each. The feet are all nearly of equal length without spines and scaly. Fig. 2 and 3 represent the Rynchaenus Strobi, or White Pine Weevil of its natural size and magnified.*

The description is sufficient to distinguish this from all the other species hitherto known. The insect is so small that it is impossible to detect it in the act of depositing its eggs, which are probably placed under the think skin or epidermis of the shoot. I suspect that the larvae remains in the wood more than one year, and that the shoot dies the second year after the eggs are placed in it. The larvae is a soft white grub, with only the head shelly, and armed with strong mandibles.

When the feeding state is passed, and before the pupa state comes on, it prepares an exit for itself by opening a passage outward, but leaves the exterior skin of the bark untouched, so that it is perfectly secured from any injury by rain. The pupa remains quiet for a time, and the perfect insect has only to cut away the epidermis to escape.

The perfect insects begin to come out early in September, and continue to leave the wood through that month and a part of October; the shoot at that time is pierced on all sides with small round holes, sometimes thirty or forty may be counted in one shoot. But an unlimited increase is not permitted to this destructive insect, if it were, our forests would scarce produce a single mast.

One of the means provided by the Creator to restrain the increase of the White Pine Weevil, is a species of Ichneumon, which deposits its eggs in the body of the larva of the weevil, and is furnished with an instrument precisely adapted to this purpose. It is a small four-winged fly 3 ½ 10ths or 7/20 of an inch in length, exclusive of the antennae and the sting. The sting is about as long as the body, the antennae about 2/3 that length. It is a full shining black; the abdomen consists of eight segments, the second, third, fourth and fifth are marked with a tubercle on each side; the first and second pair of feet are dull yellow, the third pair dusky brown; the nerves of the wings at the base, or at the union with the thorax, white; the antennae are wholly of a dusky black colour; the sting is contained in a sheath formed of two semicylindrical valves; it consists of two pieces exactly alike and exquisitely pointed; it answers the double purpose of making an aperture to receive the egg, and of conducting it into the body of the grub. The parent fly is indued with sagacity to discover the individual which is conveniently situated, and within reach of the sting. The larvae of the Ichneumon consumes that of the Weevil, which affords it a sufficient quantity of food to complete its growth; it then encloses itself in a thin covering analogous to the cocoon of the silk-worm, passes through the pupa state within the wood, and makes its escape in its perfect form.

The first shoot I examined was cut in August the last year, about the fifteenth. In order to examine it thoroughly, I broke it into pieces of two or three inches in length, and divided these pieces lengthwise with a penknife; I found some of the inhabitants in the larva form, others in different degrees of maturity in the pupa state, some of them nearly perfect. In one of the pieces I observed some other larvae, which were those of the Ichneumon. This piece carefully bound together again, and laid in a small tight box; in the mean time my attention was called to other affairs, and the box was forgotten for several months; when on opening it, I was much gratified to find two Ichneumons, one of which accompanies this communication.

I know not when this insect places its eggs in the grub, nor when it comes forth in the winged state; my object being rather to know what it was, than the time of its appearance. The knowledge, however, that such an animal exists, and the use to which it is destined in the arrangements of providence, may excite our admiration of the wisdom, and our gratitude for the goodness which governs the creation. But the Ichneumon cannot destroy the species, nor can man himself; the most effectual remedy then in our power is, to cut off the leading shoot in August, or as soon as it is perceived to be dead, an inch or two below the dead part, and commit to the fire. December 1816.

*In technical language, it may be called Rhynchaenus Strobi, femoribus muticis, rufo-griscis; thoracis punctis duobus, scutello, maculaque versus elytrorum apicem, albis. "

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

W. D. Peck

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology & Ecology

Adults of P. strobi can survive at least 4 years and reproduce in each year (McMullen and Condrashoff, 1973). Throughout most of the range of P. strobi, adults overwinter in the litter (Wallace and Sullivan, 1985); however, in Sitka spruce, adults and rarely mature larvae and pupae may overwinter in the terminals (VanderSar, 1977). Adults leave their hibernation sites in March to late April and crawl or fly to the terminal shoot of the host tree. They feed on the inner bark and cambium of the previous years leader, chewing out cavities of up to 2.5 mm in diameter. The feeding activity is influenced by stimulants in the bark and cuticle (VanderSar and Borden, 1977a; Alfaro and Borden, 1985) and by the density of resin canals (Alfaro, 1996).

The optimum temperature for flight is between 24-26 °C with a lower limit near 21 °C (MacAloney, 1930). Maximum adult feeding, mating and oviposition activity in the spring occurs on clear, warm days when bark temperatures are 26-31°C and relative humidity is low. In Maine (USA), peak numbers of beetles can be found on trees by mid-May while by early July no adults can be found on the trees (Dixon and Houseweart, 1983). There is no activity above 35°C or below 8°C. However, beetles can survive overnight temperatures of -20°C in the leaders of P. sitchensis (Hulme et al., 1986).

Oviposition occurs in the chewed-out cavities at bark temperatures of 25-29°C and relative humidity of 20-55% (Sullivan 1960). Oviposition commences about a week following emergence from overwintering sites. Several females may oviposit in the same terminal and as many as 600 eggs may be laid per terminal but the average is 100-150. Eggs closest to the top of the leader are usually laid first. Upon hatching young larvae first enlarge the egg chamber and then move down the stem singly or in small groups. Eventually the larvae come together to form a ring of larvae (feeding ring) which move down the stem. Larvae feed for 5-6 weeks and pass through four instars. Mature larvae excavate chip cocoons in the outer wood and pith, in which they pupate. New adults emerge from late July to late September, depending on environmental conditions. Males, but not females, become sexually mature before hibernation, although the latter may be inseminated at this time. Males produce an aggregating pheromone (Booth and Lanier, 1974). Active feeding of adults on phloem continues until hibernation in the duff October and November. Most adults overwinter within 30 cm of the tree bole. Adults overwintering in the terminals of Sitka spruce may feed occasionally through the winter when temperatures are sufficiently high. P. strobi can produce fertile hybrids with P. nemorensis in the laboratory (Phillips and Lanier, 1983), and there is evidence that such hybridization also occurs naturally (Boyce et al., 1994).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Brian D. Farrell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographical Distribution - Further Information

Distribution map of Pisodes strobi in North America adapted from:

  • Humble, L.M., N. Humphreys, and G.A. Van Sickle. 1994. Distribution  and hosts of the white pine weevil, Pissodes strobi (Peck), in Canada. Pages 68-75 in R.I. Alfaro, G. Kiss and R.G. Fraser (eds.). "The white pine weevil: biology, damage and management". Proceedings of a symposium held January 19-21, 1994, in Richmond, B.C. FRDA Report 226, Pacific Forestry Centre, Victoria, B.C., 311 pp.

This species is transcontinental in North America ranging from the southern part of the Yukon and Northwest Territories to Orgeon, Utah and Colorado in the west and from northern Quebec to North Carolina and northern Mississippi in the east. Records from the island of Newfoundland appear to be false.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Brian D. Farrell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution & Ecology

Pissodes strobi co-occurs with it’s coniferous hosts from the state of Georgia in the Southeastern USA, north through the maritime provinces of Canada, and west across the prairies to northern California and the Pacific Northwest.  The adults feed on the terminal leaders of their hosts, and lay eggs within the feeding holes. Microbial pathogens may also gain entry into the hostplant this way.  The adults overwinter in the soil beneath host trees, and emerge in the early spring for feeding and oviposition.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Brian D. Farrell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Physical Description

Adult

The adults are 5-8 mm long and 2-3 mm wide; color is somewhat variable from medium-to-dark brown. Prothorax, elytra and legs are marked with tufts of white and reddish-brown scales grouped to form several small spots on the prothorax and, usually, two irregular bands across the elytra. The rostrum is slender and curved and is the same length as the prothorax, with the antennae attached about midway along its length.

Larva

Legless grubs with creamy-white, wrinkled bodies and light brown heads; 10-12 mm long at maturity.

Pupa

About adult size and creamy-white when first formed, but the mandibles, eyes, rostrum, prothorax and legs become medium-brown before adult emergence

Eggs

Ovoid, 0.7-0.9 x 0.4-0.6 mm with a thin, translucent chorion.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Brian D. Farrell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

P. strobi is confined to trees of the genera Picea and Pinus and attacks many species within these genera. The principal hosts are eastern white pine (Pinus strobus) in eastern Canada and the northeastern USA, Sitka spruce (Picea sitchensis) along the Pacific coast of North America, Engelmann spruce (P. engelmannii) in western North America, and white spruce (P. glauca) transcontinentally (Humble et al., 1994).Norway spruce (P. abies), a European species widely planted in North America, is also a commonly affected host.

Hamel et al. (1994) found that P. strobi in Quebec preferred P. abies for oviposition to the native species Picea glauca and Pinus strobus. On Vancouver Island, the European Picea omorika proved as susceptible to P. strobi as P. sitchensis (Hulme and Dawson, 1992). Other European species occasionally attacked in plantations in North America include Scots pine (P. sylvestris), Austrian pine (P. nigra), Mugo pine (P. mugo) and Balkan pine (P. peuce). A comprehensive list of host plants of North American Pissodes spp. can be found in Langor (1998) and references listed therein.

P. strobi is largely an inhabitant of young regenerating stands of spruces and pines. Although it attacks trees in natural stands it prefers open-growing (low density, low shade), vigorous ornamental trees, plantations and nursery stock (Hiratsuka et al., 1995). Weevils suffer higher mortality in shaded stands, and leaders are too small for satisfactory weevil attack (Wallace and Sullivan, 1985). Although trees between 0.5 m and > 25 m tall can be attacked, trees between 1.5 m and 9 m tall sustain the highest incidence of attack. Within stands, the largest and thickest terminals sustain the highest incidence of attack (Sullivan, 1959; VanderSar and Borden, 1977b).

Brian D. Farrell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dispersal

Means of Movement and Dispersal

Natural dispersal (non-biotic)
P. strobi appears to be a fairly strong flier, and flight is the principle means of dispersal from stand to stand. Within stands beetles can also simply walk to nearby trees from overwintering sites in the duff. It appears that most individuals do not move far (Harman and Kulman, 1967; Harman, 1975).  It is not known how far this species can disperse on an annual basis.

Movement in trade/transport
International spread would most probably occur via the shipment of living conifer plants, including Christmas trees. P. strobi only attacks young growth and is unlikely to be carried by wood.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Brian D. Farrell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Notes on Natural Enemies

A summary of the natural enemies of North American Pissodes species, including identification keys and biological notes, is provided in Williams and Langor (2002c). Twenty-three species of native parasitoids are confirmed from P. strobi in North America: 5 species of Ichneumonidae, 9 of Braconidae, 4 of Pteromalidae, 3 of Eurytomidae, and one each of Chacididae and Eupelmidae. Also, one subcortical insect predator, a lonchaeid fly, Lonchaea corticis,  is a source of high mortality. The most common insect natural enemies vary from study to study and area to area (Taylor, 1929; MacAloney, 1930; Stevenson, 1967; VanderSar, 1978; Dixon and Houseweart, 1982; Nealis 1998), but in general L. corticis is among the most effective natural enemies throughout the range of P. strobi. Early larval instars of L. corticis are scavengers, feeding on frass and weakened or dead early instar weevil larvae. This predator cannot subdue P. strobi larvae, so predation is restricted to immobile pre-pupae and pupae (Hulme 1989). Natural enemies have the most severe impact on third and fourth larval instars and pupae (Dixon and Houseweart, 1982). Percent mortality of P. strobi brood due to parasitoids and L. corticis is often in excess of 50%, and sometimes near 100% (MacAloney, 1930; Stevenson, 1967).

Birds and mammals can also cause mortality of P. strobi. Birds  consume 6-9% of late larvae and pupae in terminals and mammals (shrews, mice) cause 5-13% mortality of adults overwintering in the litter (Bellocq and Smith, 1994, 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Brian D. Farrell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Systematics or Phylogenetics

Taxonomy and Nomenclature

Hopkins (1911) described two new species attacking terminal leaders of spruces in western North America, P. engelmanni and P. sitchensis, which were recognized on the basis of their associations with Engelmann spruce and Sitka spruce, respectively. Subsequent cytogenetic work (Smith and Virkki, 1978) showed that these two taxa were conspecific with P. strobi, and they were placed in synonymy.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Brian D. Farrell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physiology and Cell Biology

Physiology

Physiology and Biochemistry

Weevils are unaffected by jasmonic acid treatments in hosts:

Nicole, M.-C., G. Zeneli, R. Lavallée, D. Rioux, É. Bauce, M.-J. Morency, T. M. Fenning, and A. Seguin. 2006. White pine weevil (Pissodes strobi) biological performance is unaffected by the jasmonic acid or wound-induced defense response in Norway spruce (Picea abies). Tree Physiology 26: 1377–1389.

Pheromones and feeding stimulants are known (http://www.pherobase.com):

Alfaro, R. I., H. D. Pierce, Jr., J. H. Borden and A. C. Oehlschlager. 1980. Role of volatile and nonvolatile components of Sitka spruce bark as feeding stimulants for Pissodes strobi Peck (Coleoptera: Curculionidae). Can. J. Zool. 58: 626-632.

Booth, D. C., T. W. Phillips, A. Claesson, R. M. Silverstein, G. N. Lanier, and J. R. West. 1983. Aggregation pheromone components of two species of Pisssodes weevils (Coleoptera: Curculionidae): isolation, identification, and field activity. J. Chem. Ecol. 9: 1-12.

Hibbard, B. E. and Webster, F.X. 1993. Enantiomeric composition of grandisol and grandisal produced by Pissodes strobi and P. nemorensis and their electroantennogram response to pure enantiomers. J. Chem. Ecol. 19: 2129-2141.

Rieske, L.K. and K. F. Raffa. 1993. Use of ethanol- and turpentine-baited flight traps to monitor Pissodes weevils (Coleoptera: Curculionidae) in Christmas tree plantations. Great Lakes Entomol. 26: 155-160.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Brian D. Farrell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cell Biology

Chromosomal Data

Chromosome data are available (Smith and Virkki 1978).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Brian D. Farrell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pissodes strobi

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBCL2715-06|U77976|Pissodes strobi| AATAAATGATTTTACTCTACAAATCATAAAGATATCGGAACTTTATATTTCATTTTTGGGGCCTGATCGGGAATAATTGGTACCTCTTTA---AGTCTACTCATCCGAACAGAACTAGGTACCCCAGGAAACCTAATTGGAGAT---GATCAAATCTATAACACTATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATCATAATTGGTGGATTTGGGAATTGATTAGTTCCTTTAATA---TTAGGAGCTCCTGATATAGCTTTCCCTCGATTAAATAACATAAGATTTTGATTATTGCCCCCCTCTATTATACTACTCCTAATAAGAAGAATCACAGATAAAGGAGCAGGAACTGGATGGACTGTATACCCTCCCTTATCAACAAATATTACACACGAAGGCCCTTCAGTAGATTTA---GCAATTTTTAGACTCCACATAGCAGGAATCTCCTCTATCCTAGGAGCAGTAAATTTTATCTCAACAGTAATTAATATACGTCCAACTGGTATAAATTCTGACCAAATATCTCTATTTATTTGAGCAGTGAAAATTACTGCAATTCTCTTATTACTCTCATTACCTGTATTAGCAGGG---GCTATCACTATACTACTTACAGACCGAAATATCAATACATCTTTTTTTGACCCAGCAGGAGGGGGAGATCCAATTTTATACCAGCATCTATTTTGATTTTTTGGTCATCCCGAAGTATATATCTTAATTCTTCCAGGATTTGGGATAATCTCCCACATTATCAATCAAGAAAGAGGGAAAAAA---GAAGCCTTTGGGGTACTAGGTATAATTTATGCAATAATAGCAATTGGATTATTAGGATTTGTAGTTTGAGCCCATCATATATTTACAGTAGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pissodes strobi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

The group of morphologically similar Pissodes weevil species that includes Pissodes strobi show low allozyme divergence and the ability to hybridize under laboratory conditions. They also show expected levels of divergence (1.1%) in mitochondrial DNA within species, but have unusually high mtDNA divergence among species (6.0-7.5%),confirming early studies using restriction enzyme analyses (Sperling and Langor 1995; Boyce 1994).

Brian D. Farrell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Diagnostic Methods

Laboratory diagnoses are possible using morphological characters for live or dead adults or larvae (Williams and Langor, 2002a,b) or using cytogenetic techniques (Smith & Virkki, 1978) or molecular techniques (Langor and Sperling, 1995; 1997) for live specimens. Molecular techniques may possibly be applied to recently dead specimens but this has not yet been tested.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Brian D. Farrell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Detection and Inspection Methods

Trees between 0.5-25.0 m are attacked but trees between 1.5-9 m are mostly commonly attacked. Leaders exhibiting resin flow in spring should be examined for presence of weevils and feeding/oviposition punctures. A microscope is necessary to observe the eggs. In most cases one is not alerted to the presence of P. strobi until the terminal leader starts to wilt and fade (see below), which commences to be visible in June. If this is detected early enough in the insect life cycle, removal of bark from the previous years terminal will reveal larvae, pupae or callow adults. Terminals that are vacated (August and later) will exhibit round emergence holes of 2-4 mm diameter, the presence of old feeding and oviposition punctures and the presence of  chip cocoons. Dissection of old terminalis will also yield old larval or pupal exuvia which may be used for diagnosis. Crooks and forks in the stem and portions of dead terminals are evidence of attacks in previous years.



Image courtesy of David Langor.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Brian D. Farrell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Symptoms - Description

Symptoms of P. strobi damage are generally easily diagnosed (Hiratsuka et al., 1995). In the spring, the first signs of attack are the presence of adults and excessive resin flow from feeding punctures on the previous year's terminal leader of the pine or spruce host.  Later, feeding larvae in the phloem girdle the leader and cause the current growth to wilt in early to mid-June and then turn yellowish brown by July. Removal of bark from fading terminals will reveal larvae. Mature larvae excavate cavities in the wood and line them with wood chips. Pupation occurs in these "chip cocoons". Emerging adults make small circular holes, 2-4 mm in diameter, in the bark. Old previously infested terminals may remain attached to the tree for many years, and may be identified by the presence of feeding punctures, chip cocoons, or adult emergence holes. The killed terminal is replaced by one or more branches of the topmost whorl assuming vertical growth, so producing a crooked or forked stem. Successive attacks give rise to trees which are multiple-stemmed and cabbage-shaped. In sawn boards, damage is seen as cross grain, larger knots and compression wood.



This photo shows a tree attacked multiple times by Pissodes strobi (left) compared to unattacked tree of same age (right). This illustrates the impact on growth and form. Photo courtesy of David Langor.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Brian D. Farrell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Phytosanitary Measures

To prevent the introduction of life stages of P. strobi, EPPO recommends that the importation of plants and cut branches of host species of Picea and Pinus from North America should be prohibited (OEPP/EPPO, 1990). There is also a minor risk from conifer wood, which is effectively covered by the measures recommended by EPPO (OEPP/EPPO, 1990) for non-European Scolytidae (EPPO/CABI, 1992).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Brian D. Farrell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Control

Considerable recent effort has been invested in exploration of genetic resistance as a management tool, particularly in Sitka spruce (Alfaro and Ying, 1990; Kiss, 1991; Klimaszewski et al. 2000; King and Alfaro, 2001). Cultural control tactics by manipulation of stand densities and shading hold some promise for reducing P. strobi impact (Berry and Stiell, 1976; Taylor et al., 1996). Chemical control has been achieved by using various insecticides (see references in Langor, 1998). Stem implants containing the systemic insecticides oxydemeton-methyl or acephate have been used successfully on P. sitchensis in British Columbia (Fraser & Heppner, 1993). Some experimentation with leader and systemic applications of neem EC formulations for control of P. strobi on jack pine and white pine in Ontario have yielded good results (Helson et al., 1998). Control using juvenile hormone analogues shows some promise (Dimond and Bradbury, 1992). There is good potential for pursuing classical biological control tactics for this pest. In 1950, a braconid, Coeloides sp., was introduced from Europe and released in southern Quebec but it is unkown whether this became established (McGugan and Coppel, 1962). As well, from 1986 to 1999, the braconids, Eubazus robustus and E. semirugosus were shipped to Canada from Europe and released in cages against P. strobi (Hulme and Kenis, 2002). E. semirugosus gave the most promising results but additional work is needed before open releases can be considered.Alfaro et al. (1995) describe an integrated pest management (IPM) system relying on accurate hazard rating of plantation sites and continuous monitoring of attack levels.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Brian D. Farrell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Phytosanitary Risk

P. strobi is an EPPO A1 quarantine pest (OEPP/EPPO, 1980), but no other regional plant protection organization has cited it as a quarantine pest. As a serious pest of the introduced Picea sitchensis and the native P. abies, two very important timber species in Europe, and with an obvious potential to establish in the conditions of northern Europe which resemble those of Canada, P. strobi clearly presents a serious risk for the EPPO region. It seems to have less potential importance on European Pinus spp., since P. strobus is no longer planted to any significant extent; however, it has successfully attacked several European Pinus species in plantations in North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Brian D. Farrell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environmental Impact

As this species affects only tree form and to a small extent tree growth, and is not a source of tree mortality, there is no evidence of environmental impact.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Brian D. Farrell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Impact

Repeated attacks on the same tree cause a crooked or forked stem and bushy crown, thus reducing the tree's value as lumber. As well defects in wood due to wane, bark-encased knots and red rot due to vectored fungi can result in significant cull. In Ontario (Canada), Brace (1972) estimated that timber value was reduced by an average of 25% due to P. strobi. Later, in the same province, Gross (1985) estimated annual growth losses at 8000 m3, annual volume loss due to cull at 15400 m3 and an additional 15600 m3 of timber which suffered a 25% loss in value. In 1967 in New Hampshire (USA), volume losses caused by weevils were estimated at 40% in the saw-log portion of saw-timber trees (Godwin and Reeks, 1967). Both planting programmes and management practices have been significantly affected by this weevil. However, studies have shown that trees older than 30 years old are seldom attacked.



This image shows deformities (each marked with flagging) resulting from multiple Pissodes strobi attacks. Photo courtesy of David Langor.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Brian D. Farrell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pissodes strobi

Pissodes strobi, known as the white pine weevil or Engelmann spruce weevil, is the primary weevil attacking and destroying white pines. It was described in 1817 by William Dandridge Peck, professor of natural history and botany at Harvard University. The weevil is dark brown with white spots.

The eggs are laid inside a tree, usually white pine, Sitka spruce, white spruce, Engelmann spruce, or other pine or spruce, and the offspring feed on this tree until the host is killed.

References


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

References and More Information

Editor's Links

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Brian D. Farrell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!