Molecular Biology and Genetics

Molecular Biology

Barcode data: Diaprepes abbreviatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCATAAAGACATTGGAACTTTATATTTTATTTTTGGAGCTTGATCAGGTATAGTAGGAACATCTTTAAGAATTATAATTCGTGCTGAACTAGGAAACCCCGGATCTTTAATCGGTGATGATCAAATTTATAATGTAATTGTTACTGCTCATGCATTTATTATAATTTTTTTCATAGTTATACCAATAATAATTGGAGGATTTGGAAATTGACTAGTTCCACTAATATTAGGAGCACCTGATATAGCCTTTCCTCGACTTAACAATATAAGATTTTGATTACTACCTCCATCACTTACCTTACTTTTAATAAGAAGAATAGTTAATAAAGGTGCAGGAACAGGTTGAACGGTATACCCCCCTCTATCTGCTAACATTGCTCACGAAGGAGCATCAGTTGACTTAGCAATTTTTAGTCTTCATATAGCAGGAATCTCTTCTATTTTAGGTGCAATTAATTTTATTTCTACAATATGTAATATACGAACAACAGGTATAACCCCGGAACGAATACCCTTATTTGCATGAGCTGTAGCTATTACAGCAGTTCTTCTTCTTCTTTCTTTACCAGTTTTAGCAGGAGCCATTACTATACTTCTGACAGATCGTAATATTAACACATCTTTCTTTGATCCTGCTGGAGGAGGGGACCCAATTTTATACCAACATTTATTTTGATTTTTCGGCCATCCCGAAGTATACATTCTAATTCTTCCAGGATTTGGAATAATCTCACATATTATTAGACAAGAAAGAAGAAAAAAGGAATCTTTTGGAGTTTTAGGAATAATTTATGCAATAATAGCAATTGGTATTTTAGGATTTGTCGTATGAGCTCACCATATATTCACAGTAGGTATAGATGTAGACACTCGAGCCTATTTTACTTCAGCAACTATAATTATTGCAGTTCCTACAGGAATTAAAATTTTTAGATGATTAGCTACCTACCACGGAGCTCTTATTTCTTTTAGTCCTAGATCGTTATGATCTTTAGGCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Diaprepes abbreviatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 79
Specimens with Barcodes: 79
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Diaprepes abbreviatus

Diaprepes abbreviatus is a species of weevil that is native to the Caribbean,[1] where in Spanish it is colloquially called chichí. It is an agricultural pest in several Caribbean countries. In 1964 this weevil was accidentally introduced in the US state of Florida where it is at present a major pest of citrus. It was first discovered in southern California in 2005, where it is a pest of citrus, avocado, and nursery stock.[2] It is also known to infest sugarcane, tuber-bearing crops such as potatoes, and ornamental plants. Common names for the insect include diaprepes root weevil, citrus root weevil and sugarcane rootstock borer weevil.

The adult citrus root weevil is somewhat variable in size but just over 1 cm (0.39 in) in length on average. Its elytra are glossy black with large stripes of tiny yellowish-orange scales, and its head and legs are black. It has adhesive pads on its legs which confer the ability to adhere to very smooth surfaces. The larva is a plump pale grub with a dark head, up to 2.5 cm (0.98 in) in length. A female weevil might lay 5,000 eggs, depositing them in clusters on leaves, then folding and gluing the leaves together. After a week the larvae emerge from the eggs, fall to the ground, and burrow down to the roots of the host plant. They feed on the roots for several months, which is very damaging to the plant. While the adult weevil does feed on the foliage of the plant, it is the larvae that do the most damage. They often eat the taproot of the plant, which can kill it by depriving it of water and nutrients or by making it vulnerable to infection by fungi, or water moulds such as Phytophthora. The weevil spreads mainly by "hitchhiking" when infested plants, soil, and containers are moved from site to site.[2]

A variety of agents are being studied as possible biological pest control for the weevil, including ants, parasitic wasps, at least one virus, and Bacillus thuringiensis. The nematode Steinernema riobravis is released in irrigation water in infested fields in Florida to combat the pest.[2]

References[edit]

  1. ^ Weissling, Thomas J.; Jorge E. Peña; Robin M. Giblin-Davis; Joseph L. Knapp, Jr. "Diaprepes Root Weevil, Diaprepes abbreviatus (Linnaeus) (Insecta: Coleoptera: Curculionidae)". Electronic Data Information Source. University of Florida IFAS Extension. Retrieved 2010-07-09. 
  2. ^ a b c Jetter, K. M. and K. Godfrey. (2009). Diaprepes root weevil, a new California pest, will raise costs for pest control and trigger quarantines. California Agriculture 63:3 121-6.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!