Overview

Brief Summary

Fusarium graminearum is an ascomycete fungus that causes head blight in wheat and ear rot in corn. Crop damage in the United States over the last decade due to this fungus is estimated at several billion dollars, making it a significant plant pathogen. Additionally, F. graminearum produces mycotoxins known to be hazardous to humans and livestock.

The Fusarium genus, which includes two other species closely related to F. graminearum, has been the target of a comparative genomics project by the Broad Institute because it includes plant pathogens that cause disease in almost every economically important crop. Fusarium species are difficult to combat because of their worldwide distribution, persistence in the soil, and genetic plasticity, which allows them to evolve quickly in the face of resistant cultivars.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Rachel Sargent

Supplier: Rachel Sargent

Unreviewed

Article rating from 1 person

Average rating: 5.0 of 5

Comprehensive Description

General Description

 On Potato Sucrose Agar (PSA). Colonies. After 4 days growth ranges from 7.15-8.35 cm diameter with a mean ñ SD = 7.72 ñ 0.43; aerial mycelium floccose, white to greyish rose or white to vivid red, with deep red pigmentation. On Potato Dextrose Agar (PDA). Colonies. After 10 days growth varies from 8.5-9.5cm length with a mean ñ SD = 9.19 ñ 0.41, with dense aerial mycelium which varies from white to grayish red or white to brownish red; with deep red pigmentation; producing variable, globose, finely rough, colourless to pale brown "chlamydospores singly, in chains or in clusters, but often very slow to form. Anamorph. Sporodochia pale orange, but often rare or difficult to find. Conidia. Of only one type; macroconidia slender, falcate to straight, thick walled, 3- to 7-septate, 25-65 × 2.5-5 μm, each with a tapered and cone-shape apical cell and a well developed foot-shape basal cell; microconidia not observed. Notes. This species grows on Glycerol Nitrate Agar (G25N) with growth exceeding 2 cm diam., producing orange aerial mycelium and golden yellow or orange pigmentation; growth on mannitol medium exceeds 4 cm diameter with orange or yellow aerial mycelium and orange pigmentation; growth on Czapek-Dox Iprodione Dichloran Agar (CZID) exceeds 5 cm diam. with reddish aerial mycelium and reddish orange to brownish red or brownish red pigmentation. It produce phosphatase and peroxidase enzymes, but does not grow on tannin-sucrose agar or produce acid on creatine sucrose agar, acetylmethylcarbinol compound and urease enzyme. Different isolates respond variably towards production of pyrocatechol oxidase enzyme. 
  •  Nafady, N.A. 2008. Ecological, physiological and taxonomical studies on the genus Fusarium in Egypt. MSc thesis, Faculty of Science, Assiut University, Egypt. 
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ahmed Abdel-Azeem

Partner Web Site: Cybertruffle

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Description

Hyaline septate hyphae, conidiophores, phialides, macroconidia, and microconidia are observed microscopically. Macroconidia are two to multicelled, are sickle-shaped, and have a distinct basal foot cell and pointed distal ends. Fusarium grow rapidly on Sabouraud dextrose agar at 25°C and produce woolly to cottony, flat, spreading colonies.From the front, the color of the colony may be white, cream, tan, salmon, cinnamon, yellow, red, violet, pink, or purple. From the reverse, it may be colorless, tan, red, dark purple, or brown.

 

Fusarium boat-shaped conidium

 

The teleomorph of this organism is Gibberella zeae, and is characterized by purple to black perithecia.

 

Gibberella ascospores

 

Tom Volk’s page on Fusarium graminearum, aka Gibberella zeae

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Tom Volk, Jake Cox

Source: Mushroom Observer

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

 Egypt. 
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Cybertruffle Foundation

Partner Web Site: Cybertruffle

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fusarium species have worldwide distribution.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Tom Volk, Jake Cox

Source: Mushroom Observer

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Fusarium conidia are very distinctive; “banana-shaped” is one of the terms commonly used to describe them. Fusarium graminearum/Gibberella zeae produces only one kind of conidia – macroconidia – and these possess three septa at maturity as well as the classic Fusarium “foot cell” (see the little knob that looks like the heel of a boot? – That’s the foot cell; it originates as the point by which the conidium is attached to the conidiophore). Several Fusarium species produce small, single-celled microconidia as well as the macroconidia, and this can be used as an identifying feature. As in many Fusarium species, the conidia of F. graminearum are pink.

 

The sexual state, Gibberella zeae, is characterized by purple to black perithecia – a distinguishing feature of the genus Gibberella. The ascospores, like the conidia, are septate, usually with three septa. In a mixed culture, where both ascospores and conidia are present, you can tell them apart because the ascospores are slightly shorter and fatter than the conidia, and the ascospores lack the foot cells. The spores are shot out of the ascus at 870,000 times the force of gravity; the most powerful acceleration yet known from a biological system.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Tom Volk, Jake Cox

Source: Mushroom Observer

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

The macroconidia of Fusarium resemble that of Cylindrocarpon, but can be distinguished based on the foot cells that Fusarium species have that Cylindrocarpon does not.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Tom Volk, Jake Cox

Source: Mushroom Observer

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Fusarium graminearum is widely distributed on plants and in the soil.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Tom Volk, Jake Cox

Source: Mushroom Observer

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Fusarium graminearum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AGGAGTTCAATATATTTCTAATAATCAATTATATAACAGTGTAATTACAGCTCACGCTATATTAATGATATTCTTCATGGTTATGCCAGCATTAATAGGTGGGTTTGGAAATTTTTTAATGCCTTTAATGGTAGGTGGTCCGGATATGGCATTCCCTAGATTAAATAATATAAGTTTCTGATTATTACCTCCTAGTTTAATATTATTGGTATTTTCAGCCATAATTGAAGGTGGAGTGGGTACAGGTTGAACACTTTATCCCCCATTATCAGGATTACAAAGTCATAGCGGACCAAGTGTAGATCTTGCTATTTTTACTTTACATTTAACAGGGGTAAGTAGTTTATTAGGATCGATAAATTTTATAACAACAATTGTAAATATGAGAACGCCAGGAATAAGATTACATAAATTAGCATTATTCGGATGAGCAGTAGTTATAACAGCAGTATTACTTTTATTATCATTACCTGTATTAGCTGGTGGTATAACTATGGTGTTAACAGATAGAAATTTTAATACATCATTCTTTGAAGTAGCAGGTGGAGGAGATCCTATATTATTCCAACATCTTTTCTGATTCTTCGGACA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Fusarium graminearum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Uses

This ascomycete fungus is the causal agent of head blight of wheat and, as such, has caused an estimated several billion dollars worth of damage in the US alone over the past decade. Plant pathologist study plant diseases in an effort to be able to control them. Every crop plant has a cadre of diseases that affect the way it can be used by people or at least affect its yield.

 

F. graminearum is a plant pathogen and soil saprophyte. This organism causes wheat headblight disease and ear rot of corn. Fusarium head blight causes significant losses in yield and quality. The common symptom is the blighted or bleached heads. Partially blighted heads are most common, and the head blight symptom is most easily recognized in wheat. The symptoms are more difficult to recognize in barley. The grains in blighted heads often do not fill properly. Kernels can be shriveled and bleached, and these Fusarium damaged kernels, or FDK, are also known as tombstone kernels.

 

Fusarium graminearum also produces mycotoxins which can be harmful to human and animals that ingest contaminated wheat. The two main mycotoxins are deoxynivalenol (DON), also known as vomitoxin, and zearalenone. DON inhibits protein biosynthesis and zearalenone is an estrogen analog. These mycotoxins can contaminate food and when ingested by humans can cause vomiting and liver damage. Reproductive defects are also seen in livestock. In farm animals, zearalenone has been known to cause abortions in pregnant females, and feminization of males.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Tom Volk, Jake Cox

Source: Mushroom Observer

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!