Articles on this page are available in 1 other language: Spanish (9) (learn more)

Ecology

Associations

Plant / associate
fruitbody of Hygrocybe conica var. olivaceonigra is associated with live Poaceae

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hygrocybe conica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGCTTTTTCAGTATTAATTAGATTAGAATTATCTTCTCCAGGTGTACAATTTTTACAAGGAGATCACCAATTATTTAATGTTATTATAACAGCTCACGCTTTTATAATGATCTTTTTTATGGTAATGCCTGGACTTGTTGGAGGTTTTGGTAATTATTTATTACCTGTTCAAATAGGAGCCCCTGATATGGCATTTCCTAGATTGAATAATATTTCTTTTTGGTTATTACCTCCTTCTTTAATTTTATTGCTTGTTAGTTCTTTAGTAGAAAATGGAGCAGGTACAGGATGGACAGTTTATCCGCCTTTATCTAGCATTCAATCACATTCAGGAGGTAGCGTTGATTTAGCTATTTTTAGTTTACACCTTGCAGGAGTTTCTTCTTTATTAGGTGCTATTAATTTTATAACTACTGTACTTAATATGAGAACTAATGGGATGAGTTTACACAAATTACCTTTATTTGTATGGGCAATTTTTGTAACTGCTATACTATTATTACTTGCATTACCTGTATTAGCTGGTGCAATCACTATGCTTCTTACAGATAGAAACTTTAATACTAGTTTCTATGATCCAGCAGGAGGTGGTGATCCTATTCTATATCAACATCTATCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hygrocybe conica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Hygrocybe conica

Hygrocybe conica
View the Mycomorphbox template that generates the following list
Mycological characteristics
gills on hymenium
cap is conical
hymenium is adnexed
stipe is bare
spore print is white
ecology is mycorrhizal
edibility: inedible

Hygrocybe conica, commonly known as the witch's hat, conical wax cap or conical slimy cap, is a colourful member of the genus Hygrocybe (the waxcaps), found across northern Europe and North America. Originally described as Hygrophorus conicus, it may actually be a complex of closely related and similar species.

Contents

Description

Showing some black discolouration

The witch's hat is a small mushroom, with a convex to conical yellow-orange to red cap 2 to 5 cm (¾-2 inches) in diameter, though very occasionally larger specimens up to 8 or 9 cm (3½ in) diameter are found. Bruises black.

Distribution and habitat

The witch's hat is widely distributed in grasslands and conifer woodlands across North America, Europe and Asia, as well as Australia and New Zealand, being found in summer and autumn. It is likely that what is currently termed Hygrocybe conica is actually a complex of closely related species, some of which are suspected of being poisonous.[1] Though Hygrocybe conica does occur in Australia, principally near urban areas, many collections originally assigned to this species are actually the similar Hygrocybe astatogala.[2]

Edibility

The edibility or otherwise of Hygrocybe conica is unclear. Its small size and being coated in a sticky substance render it of limited palatability anyway, however there is a report of poisoning from China in the early part of the 20th century which was allegedly from this species.[3]

See also

References

  1. ^ Nilsson, Sven & Persson, Olle (1977). Fungi of Northern Europe 2: Gill-Fungi. Penguin, New York. ISBN 0-14-063006-6.
  2. ^ Young, A.M. (2005). Fungi of Australia: Hygrophoraceae. (Australian Biological Resources Study) CSIRO, Canberra, ACT. ISBN 0-643-09195-5.
  3. ^ Mushroomexpert page on Hygrocybe conica
  • Phillips, Roger (1991). Mushrooms of North America. Little, Brown & Co., New York. ISBN 0-316-70612-4.
  • Führer, Bruce Alexander (2005) A Field Guide to Australian Fungi Bloomings Books, Melbourne, Australia, ISBN 1-876473-51-7 ;
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!