Molecular Biology and Genetics

Molecular Biology

Barcode data: Acontia BioLep02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTGGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCCCTTATACTAGGAGCTCCTGATATAGCTTTCCCACGAATAAACAATATAAGTTTTTGACTACTTCCACCTTCACTTACCCTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTTTACCCCCCTCTTTCCTCTAATATTGCTCATGGAGGAAGCTCAGTCGATTTAGCAATTTTTTCCCTTCATTTAGCTGGAATTTCCTCTATTTTAGGGGCAATTAATTTCATTACTACTATTATTAATATACGATTAAATAATTTATCATTTGATCAAATACCATTATTTATCTGAGCTGTTGGAATTACTGCATTTTTATTACTTCTTTCTTTACCAGTATTAGCCGGAGCTATCACTATATTATTAACTGATCGTAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acontia BioLep02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acontia Janzen368

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acontia GB02Sa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acontia elaeoa PS1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:461Public Records:59
Specimens with Sequences:434Public Species:8
Specimens with Barcodes:427Public BINs:10
Species:60         
Species With Barcodes:52         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Acontia

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Acontia

Acontia is a genus of moths of the Noctuidae family. Eusceptis, Pseudalypia and Spragueia are sometimes included in the present genus, but here they are tentatively treated as different pending further research. Many species of Tarache were also once placed here (see below).

Species

Former species

The following species were recently transferred to the Tarache genus:

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!