Overview

Brief Summary

Common Names

Vine Hawkmoth
Impatiens Hawkmoth
Public Domain

 

Supplier: Frances O'Brien

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Defense Mechanisms

In defence, the larvae may vomit a green bile. The larvae are also highly sensitive, wriggling wildly if even only slightly touched.
The same may also be said of the pupae, which can move so vigorously that they can move several centimetres.

Public Domain

 

Supplier: Frances O'Brien

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Theretra oldenlandiae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACATTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCAGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTACAATACAATTGTTACAGCCCATGCCTTTATTATAATTTTTTTTATAGTTATGCCAATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCACCTGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCTCTCACCCTTTTAATTTCTAGTAGCATTGTTGAAAATGGAGCAGGAACTGGTTGAACAGTTTACCCCCCTCTCTCATCTAACATTGCTCATAGAGGAAGTTCAGTAGATTTAGCAATTTTCTCTCTTCACTTAGCCGGAATTTCATCAATTATAGGGGCCGTAAACTTTATTACAACAATTATTAATATACGAATTAATAATTTATCTTTTGACCAAATACCATTATTTGTTTGAGCCGTAGGAATTACAGCATTTTTATTATTATTATCCTTACCAGTATTAGCAGGTGCAATCACTATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGATCCCGCTGGAGGAGGTGATCCTATCTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Theretra oldenlandiae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Theretra oldenlandiae

The Impatiens Hawk Moth (Theretra oldenlandiae) is a member of the Sphingidae family found in India, China, Borneo, Japan, Philippines, Thailand, and Australia.

They are often considered a pest on both Busy lizzie (Impatiens wallerana) and Fuchsias (Fuchsia sp.). Caterpillars of this species have also been seen feeding on Arum lily (Zantedeschia aethiopica), Argentine trumpet vine (Clytostoma callistegioides), Climbing guinea flower (Hibbertia scandens), Billy goat plum (Planchonia careya), Godetia (Clarkia amoena), Star cluster (Pentas lanceolata), Australian native violet (Viola hederacea) and Slender grape (Cayratia clematidea). The larvae are black with yellow dots, they have a small spine on their tails and use it as a mimicked head. Before pupating the caterpillar will reach a length of about 70 mm.

The adult is brown with light brown stripes down the thorax. The stripes are mimicked on the inner margin of the forewing.[2]

Subspecies

  • Theretra oldenlandiae oldenlandiae (from Sri Lanka and southern India north to northern Pakistan, northern Afghanistan, Nepal, Bhutan and Myanmar. Then northeastwards through China to Taiwan, South Korea and Japan, and then southeastwards through South East Asia as far as the Andaman Islands, the Solomon Islands and the Philippines. Strongly migratory northward to northeastern China (Heilongjiang, Liaoning and Jilin), eastern Russia (Primorskiy Kray) and northern Japan)[3]
  • Theretra oldenlandiae lewini (Thon, 1828) (Australia)
  • Theretra oldenlandiae samoana Gehlen, 1941 (Samoa)

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!