Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Bactromyia aurulenta is endoparasitoid of larva of Calliteara pudibunda

Animal / parasitoid / endoparasitoid
Carcelia gnava is endoparasitoid of Calliteara pudibunda

Animal / parasitoid / endoparasitoid
larva of Carcelia tibialis is endoparasitoid of larva of Calliteara pudibunda
Remarks: Other: uncertain

Animal / parasitoid / endoparasitoid
larva of Compsilura concinnata is endoparasitoid of larva of Calliteara pudibunda

Animal / parasitoid / endoparasitoid
larva of Gonia ornata is endoparasitoid of larva of Calliteara pudibunda

Animal / parasitoid / endoparasitoid
larva of Nilea hortulana is endoparasitoid of larva of Calliteara pudibunda

Animal / parasitoid / endoparasitoid
larva of Phryxe nemea is endoparasitoid of larva of Calliteara pudibunda

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calliteara pudibunda

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCTGGTATAATTGGAACTTCCCTAAGATTATTAATTCGAGCAGAATTAGGAAACCCAGGATCATTAATTGGAAATGATCAAATTTATAATACTATTGTAACAGCTCATGCATTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTACCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGATTACTCCCCCCTTCCCTAACCTTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATAGAGGAAGATCTGTTGACTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACCACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCCTTATTTGTATGAGCGGTTGGTATTACAGCTTTTTTATTGCTTCTCTCTCTTCCAGTTCTTGCTGGAGCTATTACCATACTTCTAACTGATCGTAATTTGAATACATCATTTTTTGATCCTGCAGGAGGAGGGGATCCTATTTTATATCAACACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Calliteara pudibunda

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 40
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Calliteara pudibunda

The Pale Tussock (Calliteara pudibunda) is a moth of the Lymantriidae family. It is found in Europe and Anatolia.

The Dutch common name for the moth (Meriansborstel) is named for famous butterfly and insect painter Anna Maria Sibylla Merian.

Technical Description and variation[edit]

See glossary for terms used

The wingspan is 40–60 mm.Female: Forewing greyish white dusted with dark, and bearing dark wavy transverse lines edged with pure white on the inner side. Hindwing white with indication of a dark submarginal band.Male: Forewing olive-grey, with black median area and darker indistinct slightly wavy transverse lines in the marginal and basal areas. Hindwing greyish yellow, with a transverse band which is slightly more distinct than in the female, and sometimes forms an elbowed anal. juglandis Hbn. denotes a form which is rather strongly divergent in the male, being distinguished by a greyish white head and thorax (in typical specimens this is dark brown or only slightly lighter), as well as by a whitish basal area of the forewing. The median area is grey with blackish discocellular spot and marginal lines; hindwing with distinct dark submarginal band and discocellular spot. In the female the submarginal band of the hindwing is also more distinct than in typical specimens, ab. concolor Stgr. has dark grey forewing, unicolorous or with only traces of transverse lines. [1]

Biology[edit]

The moth flies from April to June.

Egg light yellowish brown with dark median spot. Larva usually light lemon-yellow, but sometimes brownish yellow, violet or blackish grey, with deep black segmental incisions, lighter dorsal brushes and red or brown pencil on the 11th segment.The larvae feed on Oak, Willow, Birch, Prunus and Crataegus species.

References[edit]

  1. ^ Seitz, A. Ed. Die Großschmetterlinge der Erde, Verlag Alfred Kernen, Stuttgart Band 2: Abt. 1, Die Großschmetterlinge des palaearktischen Faunengebietes,Die palaearktischen Spinner und Schwärmer, 1912- 1913
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!