Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Bactromyia aurulenta is endoparasitoid of larva of Calliteara pudibunda

Animal / parasitoid / endoparasitoid
Carcelia gnava is endoparasitoid of Calliteara pudibunda

Animal / parasitoid / endoparasitoid
larva of Carcelia tibialis is endoparasitoid of larva of Calliteara pudibunda
Remarks: Other: uncertain

Animal / parasitoid / endoparasitoid
larva of Compsilura concinnata is endoparasitoid of larva of Calliteara pudibunda

Animal / parasitoid / endoparasitoid
larva of Gonia ornata is endoparasitoid of larva of Calliteara pudibunda

Animal / parasitoid / endoparasitoid
larva of Nilea hortulana is endoparasitoid of larva of Calliteara pudibunda

Animal / parasitoid / endoparasitoid
larva of Phryxe nemea is endoparasitoid of larva of Calliteara pudibunda

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Calliteara pudibunda

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 40
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Calliteara pudibunda

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCTGGTATAATTGGAACTTCCCTAAGATTATTAATTCGAGCAGAATTAGGAAACCCAGGATCATTAATTGGAAATGATCAAATTTATAATACTATTGTAACAGCTCATGCATTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTACCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGATTACTCCCCCCTTCCCTAACCTTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATAGAGGAAGATCTGTTGACTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACCACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCCTTATTTGTATGAGCGGTTGGTATTACAGCTTTTTTATTGCTTCTCTCTCTTCCAGTTCTTGCTGGAGCTATTACCATACTTCTAACTGATCGTAATTTGAATACATCATTTTTTGATCCTGCAGGAGGAGGGGATCCTATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Calliteara pudibunda

The Pale Tussock (Calliteara pudibunda) is a moth of the Lymantriidae family. It is found in Europe and Anatolia.

The Dutch common name for the moth (Meriansborstel) is named for famous butterfly and insect painter Anna Maria Sibylla Merian.

The wingspan is 40–60 mm. The moth flies from April to June.

The larvae feed on Oak, Willow, Birch, Prunus and Crataegus species.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!