Articles on this page are available in 1 other language: Arabic (11) (learn more)

Overview

Comprehensive Description

General Description

A medium sized Crambus (25-28 mm wingspan). The forewings are silvery white with a longitudinal orange discal stripe; the narrow terminal line is brown with five dark brown dashes in the lower part. The hindwings are white and often smoky away from the margin. Probably the easiest recognized of any of the species. Crambus perlellus is also silvery white but lacks the orange stripe.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

A North American species. Fernald (1896) mentions it from Ontario, Maine, New Hampshire, Massachusetts, New York, Pennsylvania, Maryland and Ohio. In addition, Handfield has it from Quebec and Labrador (1997), and Scholtens (1996) from Michigan. In Alberta, it occurs in the prairies and aspen parkland (Bowman (1951).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Prairie, aspen parkland and conifer forest.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

No local information. Fernald (1896) says "grass roots".
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

June and July.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Diurnal and comes to light. The egg and early stages have been described by Felt (1894).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Crambus girardellus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGGATTTGAGCAGGAATAGTAGGAACATCTCTAAGATTATTAATTCGTGCTGAATTGGGAAACCCTGGATTTTTAATTGGTGATGATCAAATTTATAATACTATTGTTACTGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAATTGATTAGTACCTCTAATATTGGGTGCTCCAGATATAGCTTTCCCACGAATAAACAATATAAGATTTTGATTACTACCCCCCTCTTTAACTTTATTAATTTCTAGAAGAATTGTAGAAAACGGAGCTGGAACAGGATGAACGGTATACCCCCCCCTTTCATCTAATATTGCTCACGGAGGAAGATCAGTTGATCTAGCTATTTTTTCCCTGCATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATCATTAATATACGAATTAATGGTTTATCTTTTGATCAAATATCACTATTCATTTGATCAGTTGGAATTACCGCCCTCCTATTACTTTTATCTCTTCCTGTCTTAGCAGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACATCTTTTTTTGACCCCGCTGGAGGAGGTGATCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Crambus girardellus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Rather uncommon but of no concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Crambus girardellus

Girard's Grass-veneer Moth (Crambus girardellus) is a moth in the Crambidae family. It is found in North America,[2] including Alberta, Ontario, Quebec, Labrador, Maine, New Hampshire, Massachusetts, New York, Pennsylvania, Maryland, Ohio and Michigan.

The wingspan is 25–28 mm. The forewings are silvery white with a longitudinal orange discal stripe and a narrow brown terminal line. The hindwings are white. Adults are on wing in June and July.[3]

The larvae feed on the roots of grass species.

References


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!