Overview

Comprehensive Description

Comments

Occasionally, blackberries (Rubus spp.) are found along the edges of prairies. It can be difficult to tell the different species apart. This is one of the more common blackberries in Illinois. The fruits of Common Blackberry tend to be a bit larger and more elongated than those of other blackberries, and they usually have an excellent flavor. This blackberry is distinguished from other blackberries by the numerous glandular hairs on the peduncles and pedicels of its elongated racemes of flowers. Furthermore, its mature leaflets are usually no more than twice as long as they are wide. These two characteristics distinguish the Common Blackberry from other Rubus spp. in Illinois. Return
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This native woody shrub forms canes that are initially erect, but often bend downward to re-root in the ground. These canes actively grow and form leaves during the first year, and develop fruits in the form of drupes during the second year, afterwhich they die down. The canes are about 3-6' tall; they are green where there is new growth at the tips, otherwise they are brown or reddish brown with stout prickles that are straight or somewhat curved. The alternate leaves are usually trifoliate or palmately compound; they have long petioles. The leaflets are up to 4' long and 3' across; they are up to twice as long as wide. A typical leaflet is usually ovate with coarse, doubly serrate margins; it may have a few scattered white hairs on the upper surface, while the lower surface is light green and pubescent.  The canes develop racemes with about 12 white flowers; these racemes are much longer than they are wide. There are conspicuous glandular-tipped hairs on the peduncles and pedicels of the inflorescence. A flower has 5 white petals and 5 green sepals with pointed tips; this flower is about ¾-1' across. The petals are longer than the sepals, rather rounded, and often wrinkly. In the center of each flower, are numerous stamens with yellow anthers surrounding a green reproductive structure with a prickly appearance. The flowers bloom during late spring or early summer for a month; there is little or no floral fragrance. The drupes develop later in the summer; they are about ¾' long and 1/3' across, although their size varies with moisture levels. The drupes are initially white or green, but eventually turn red, finally becoming almost black. They are seedy and have a sweet flavor when fully ripened. The root system consists of a taproot. This plant often forms loose colonies vegetatively.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Localities documented in Tropicos sources

Rubus nigrobaccus L.H. Bailey:
Canada (North America)
United States (North America)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Localities documented in Tropicos sources

Rubus nuperus L.H. Bailey:
United States (North America)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Localities documented in Tropicos sources

Rubus attractus L.H. Bailey:
Canada (North America)
United States (North America)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Localities documented in Tropicos sources

Rubus allegheniensis var. allegheniensis :
United States (North America)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Localities documented in Tropicos sources

Rubus allegheniensis fo. allegheniensis :
United States (North America)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Localities documented in Tropicos sources

Rubus allegheniensis var. plausus L.H. Bailey:
Canada (North America)
United States (North America)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Localities documented in Tropicos sources

Rubus allegheniensis var. populifolius Fernald:
United States (North America)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Localities documented in Tropicos sources

Rubus allegheniensis Porter:
Canada (North America)
United States (North America)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Isotype for Rubus fissidens L.H. Bailey
Catalog Number: US 2216359
Collection: Smithsonian Institution, National Museum of Natural History, Department of Botany
Verification Degree: Original publication and alleged type specimen examined
Preparation: Pressed specimen
Collector(s): S. Smith
Year Collected: 1940
Locality: Hungerford Quarry, Ellis Hollow Road., Tompkins, New York, United States, North America
  • Isotype: Bailey, L. H. 1944. Gentes Herb. 5: 551.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Botany

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Isotype for Rubus fissidens L.H. Bailey
Catalog Number: US 2216358
Collection: Smithsonian Institution, National Museum of Natural History, Department of Botany
Verification Degree: Original publication and alleged type specimen examined
Preparation: Pressed specimen
Collector(s): S. Smith
Year Collected: 1940
Locality: Relict dump, Hungerford Quarry, Ellis Hollow Road., Tompkins, New York, United States, North America
  • Isotype: Bailey, L. H. 1944. Gentes Herb. 5: 551.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Botany

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Associations

Faunal Associations

The nectar and pollen of the flowers attract many kinds of insects, especially long-tongued and short-tongued bees. This includes honeybees, bumblebees, Little Carpenter bees, Nomadine Cuckoo bees, Mason bees, Green Metallic bees and other Halictid bees, and Andrenid bees. Other visitors of the flowers include wasps, flies, small to medium-sized butterflies, skippers, and beetles. Many of the flies and beetles feed on pollen and are not very effective at pollination. The caterpillars of the butterfly Satyrium liparops strigosum (Striped Hairstreak) and several species of moths feed on the Common Blackberry (see Moth Table). Also, various upland gamebirds, songbirds, and mammals feed on the fruit, stems, or foliage of this plant (see Wildlife Table). Among the upland gamebirds, the Greater Prairie Chicken, Wild Turkey, Bobwhite, and Ring-Necked Pheasant have been observed eating the drupes of blackberries. These various animals help to distribute the seeds far and wide. The Common Blackberry provides some shelter and shrubby protection to various ground-nesting birds and small mammals, such as the Cottontail Rabbit. In general, the ecological value of blackberries is very high. Photographic Location
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Flower-Visiting Insects of Common Blackberry in Illinois

Rubus allegheniensis (Common Blackberry)
(Bees collect pollen or suck nectar; Syrphid flies and beetles usually feed on pollen & are less effective pollinators; other insects suck nectar; most observations are from Robertson, although one observation is from Moure & Hurd)

Bees (long-tongued)
Apidae (Apinae): Apis mellifera sn cp fq; Apidae (Bombini): Bombus auricomus sn, Bombus griseocallis sn cp, Bombus impatiens sn, Bombus pensylvanica sn cp fq, Psithyrus variabilis sn; Anthophoridae (Anthophorini): Anthophora abrupta sn; Anthophoridae (Ceratinini): Ceratina dupla dupla sn cp fq; Anthophoridae (Eucerini): Synhalonia rosae sn, Synhalonia speciosa sn icp; Anthophoridae (Nomadini): Nomada affabilis sn fq, Nomada ovatus sn, Nomada sayi sn, Nomada superba superba sn fq; Megachilidae (Coelioxini): Coelioxys octodentata sn, Coelioxys sayi sn; Megachilidae (Megachilini): Megachile brevis brevis sn, Megachile centuncularis sn, Megachile mendica sn; Megachilidae (Osmiini): Hoplitis cylindricus sn cp, Hoplitis pilosifrons sn cp, Osmia lignaria lignaria sn cp fq; Osmia pumila sn cp

Bees (short-tongued)
Halictidae (Halictinae): Agapostemon sericea sn, Agapostemon virescens sn, Augochlorella aurata sn cp, Augochlorella striata sn cp, Augochloropsis metallica metallica sn cp, Halictus confusus sn cp fq, Halictus ligatus sn cp, Halictus rubicunda sn, Lasioglossum forbesii cp np, Lasioglossum imitatus cp np, Lasioglossum pectoralis sn cp fq, Lasioglossum versatus cp np, Lasioglossum vierecki (MH), Paralictus simplex sn; Halictidae (Sphecodini): Sphecodes cressonii sn, Sphecodes dichroa sn; Colletidae (Colletinae): Colletes aestivalis sn, Colletes inaequalis sn cp; Colletidae (Hylaeinae): Hylaeus mesillae sn; Andrenidae (Andreninae): Andrena carlini sn, Andrena crataegi sn cp, Andrena dunningi sn, Andrena forbesii sn cp, Andrena imitatrix imitatrix sn, Andrena mandibularis sn, Andrena nuda sn, Andrena personata sn cp, Andrena sayi sn cp

Wasps
Sphecidae (Crabroninae): Lestica confluentus; Sphecidae (Sphecinae): Ammophila nigricans, Isodontia apicalis; Vespidae (Eumeninae): Euodynerus annulatus, Leionotus ziziae (Rb, MS), Parancistrocerus vagus, Stenodynerus histrionalis

Flies
Syrphidae: Didea fuscipes fp np, Eristalis dimidiatus fp np, Paragus bicolor sn np, Sphaerophoria contiqua sn, Syritta pipiens fp, Syrphus ribesii fp np, Toxomerus marginatus fp np, Tropidia mamillata sn; Empidae: Empis distans sn; Bombyliidae: Aldrichia ehrmanii fp fq np, Bombylius atriceps sn; Conopidae: Zodion fulvifrons sn; Tachinidae: Archytas aterrima sn, Cylindromyia euchenor sn, Spallanzania hesperidarum sn

Butterflies
Nymphalidae: Chlosyne nycteis, Vanessa atalanta; Lycaenidae: Lycaena hyllus; Pieridae: Colias philodice, Pontia protodice;

Skippers
Hesperiidae: Epargyreus clarus, Erynnis juvenalis, Euphyes vestris, Poanes zabulon, Polites peckius, Polites themistocles

Moths
Ctenuchidae: Cisseps fulvicollis

Beetles
Scarabaeidae (Cetoniiae): Euphoria fulgida fp np, Euphoria sepulcralis fp np, Trichiotinus piger sn fp

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rubus allegheniensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGATATAGGGACTCTATATTTCATCTTCGGTGCTATTGCTGGAGTGATGGGCACATGCTTCTCAGTACTGATTCGTATGGAATTAGCACGACCCGGCGATCAAATTCTTGGTGGGAATCATCAACTTTATAATGTTTTAATAACGGCTCACGCTTTTTTAATGATCTTTTTTATGGTTATGCCGGCGATGATAGGTGGATTTGGTAATTGGTTTGTTCCTATTCTGATAGGTGCACCTGACATGGCATTTCCACGATTAAATAATATTTCATTCTGGTTGTTGCCACCAAGTCTCTTGCTCCTATTAAGCTCAGCCTTAGTAGAAGTGGGTAGCGGGACTGGGTGGACGGTCTATCCGCCCTTAAGTGGTATTACCAGCCATTCTGGAGGAGCTGTTGATTTAGCAATTTCTAGTCTTCATCTATCTGGTGTTTCATCCATTTTAGGTTCTATCAATTTTATAACAACTATCTCCAACATGCGTGGACCTGGAATGACTATGCATAGATCACCCCTATTTGTGTGGTCCGTTCCAGTGACAGCATTCCTACTTTTATTATCACTTCCGGTACTGGCAGGGGCAATTACCATGTTATTAACCGATCGAAACTTTAATACAACCTTTTCTGATCCCGCTGGGGGGGGAGACCCCATA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Rubus allegheniensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

NatureServe Conservation Status

Rounded Global Status Rank: T5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Cultivation

The preference is light shade to full sun, and mesic conditions; some drought is tolerated, although this can reduce the size of the drupes. Growth is best in rich fertile soil; a clay-loam or rocky soil is also acceptable. This plant is easy to grow from transplants or cuttings of young growth. It can become aggressive and be difficult to eliminate; the use of herbicides may be required on some occasions. Range & Habitat
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Rubus allegheniensis

Rubus allegheniensis is a species of bramble, known as Allegheny blackberry and simply as common blackberry.[2] Like other blackberries, it is a species of flowering plant in the rose family. It is very common in eastern North America, with isolated populations also found in the Central United States, California, and British Columbia.[3]

Contents

Description[edit]

Characteristics can be highly variable.[2] It is an erect bramble, typically 5 feet (though rarely over 8 feet) high, with single shrubs approaching 8 feet or more in breadth, although it usually forms dense thickets of many plants. Leaves are alternate, compound, ovoid, and have toothed edges.[2]

Thorny canes, with white, 5-petal, ¾ inch flowers in late spring and glossy, deep-violet to black, aggregate fruit in late summer.[2] Shade intolerant.[4]

Distribution and habitat[edit]

Allegheny blackberry is abundant in most of eastern North America, and can also be found in the central United States, California, and British Columbia.[3]

The presence of Rubus allegheniensis influences the dynamics of the understory vegetation of many forests in the eastern United States. An abundance of Rubus allegheniensis encourages new tree seedlings. Where the effects of herbivorous animals (such as deer) reduce the abundance of Allegheny blackberry, a competitor, Dennstaedtia punctilobula, takes over. Where Dennstaedtia punctilobula becomes common, the growth of tree seedlings is restricted.[5]

Concentrations of Rubus allegheniensis increase greatly after events that destroy taller shrubs and trees and thus permit more light into the understory, such as fires or widespread blowdown.[4][6] These populations often decline in later years as the tree seedlings sheltered by the blackberry canes grow and reduce the amount of light reaching the lower levels.[4]

References[edit]

  1. ^ "Rubus allegheniensis information from NPGS/GRIN". GRIN Taxonomy for Plants. USDA Germplasm Resources Information Network (GRIN). Retrieved 26 September 2012. 
  2. ^ a b c d "Common Blackberry (Rubus allegheniensis)". Missouri Department of Conservation Field Guide. Missouri Department of Conservation. Retrieved 26 September 2012. 
  3. ^ a b "PLANTS Profile for Rubus allegheniensis (Allegheny blackberry)". USDA. Retrieved 26 September 2012. 
  4. ^ a b c Peterson, Chris J., and Steward T.A. Pickett. "Forest reorganization: a case study in an old-growth forest catastrophic blowdown." Ecology. 76 (1995): 763+. Retrieved 14 Oct. 2012.
  5. ^ "Wildlife Management." The Princeton Guide to Ecology. Princeton: Princeton University Press, 2009. Retrieved 14 October 2012.
  6. ^ "Vegetation of Hooper Branch Nature Preserve, Iroquois County, Illinois." Northeastern Naturalist. 17 (2): pp 261-272. 2010
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Well-marked species within the blackberry group of the genus Rubus; recognition of varieties is questionable since they are broadly sympatric. LEM 7Jun99.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!