Overview

Comprehensive Description

Description

 Tubifex tubifex is a slender segmented worm that may grow up to 20 cm in length. The number of body segments may number between 34-120 and have on each side an upper and lower bundle of chitinous bristles (setae), these are used for burrowing. The worm may appear red in colour owing to the possession of the respiratory pigment haemoglobin. The species is a hermaphrodite, with a complex reproductive system.Oligochaetes are segmented, bilaterally symmetrical, cylindrical worms, with tapering ends. Typically each body segment possesses four bundles of setae (chitinous bristles projecting from the body). The setae vary considerably in size and shape, and between families, so are consequently used extensively in identification. Examination under a microscope and of internal anatomy is likely to be required for accurate identification (see Brinkhurst, 1982), and attention paid to the rather complex reproductive organs. The number of gonads, the position of one gonad relative to the other, and the body segments in which they occur are used to define families. In the Tubificidae the form of the male duct is used to define genera.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

European waters (ERMS scope), New Zealand Exclusive Economic Zone, North West Atlantic, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

upstream part of middle St. Lawrence estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Normally in calm waters, but can tolerate rough waters. infralittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 3 - 3
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Inhabits cohesive muds in a variety of habitats and is tolerant of oxygen deficiency. It is especially abundant in polluted sediments and marginal habitats not occupied by many other species, e.g. upper estuaries where interstitial salinity is less than 5 psu.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tubifex tubifex

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 53 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTGGAATTTGAGCTGGAATAGTAGGAACAGGTACAAGCCTCTTAATCCGCTTAGAATTAGCTCAGCCTGGCTCTTTCTTGGGCAGA---GACCAACTATATAACACTCTAGTTACAGCCCATGCATTCCTGATAATCTTCTTTATAGTAATACCTATCTACATTGGTGGTTTTGGCAATTGACTGGTTCCACTTATATTAGGGGCACCTGATATAGCATTTCCACGATTAAATAACTTAAGATTTTGACTACTACCCCCTTCCTTAATTCTTCTAGTATCATCGGCAGCGGTTGAAAAAGGGGCTGGAACTGGGTGAACCGTTTATCCTCCACTATCAAGAAATCTTGCACACTCGGGCCCATCCGTAGACCTTGCAATCTTCTCACTCCACTTAGCCGGGGTAGCCTCAATTTTAGGCGCTATCAATTTCATTACCACAATAATTAACATACGATGAAAAGGTATACGGTTAGAACGAATTCCATTATTCGTGTGATCAGTAATTCTGACAGTAATTCTATTACTGCTTACCTTACCTGTACTAGCAGGCGCTATTACTATACTCCTGACAGATCGAAACCTAAATACATCATTCTTTGATCCTGCTGGTGGCGGTGATCCAGTTCTTTACCAACATCTATTCTGATTCTTTGGGCATCCTGAAGTCTACATTCTTATTTTACCTGGATTCGGGGCAATCTCACATATCGTAGCATATAACACAGCTAAACTTGAACCATTCGGTTCCTTAGGTATAATCTATGCTATAATGGGAATCGCTATTGTGGGCTTTATCGTTTGAGCACATCATATATTCACTGTAGGTCTAGATGTAGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tubifex tubifex

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 53
Specimens with Barcodes: 53
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Tubifex tubifex

Tubifex, in Aa River (north of France) in a polluted zone, circa 1990

Tubifex tubifex, also called the sludge worm, or sewage worm, is a species of tubificid segmented worm that inhabits the sediments of lakes and rivers on several continents. Tubifex probably includes several species, but distinguishing between them is difficult because the reproductive organs, commonly used in species identification, are resorbed after mating, and because the external characteristics of the worm vary with changes in salinity. These worms ingest sediments, selectively digest bacteria, and absorb molecules through their body walls.

The worms can survive with little oxygen by waving hemoglobin-rich tail ends to exploit all available oxygen, and can exchange carbon dioxide and oxygen through their thin skins, in a manner similar to frogs. They can also survive in areas heavily polluted with organic matter that almost no other species can endure. By forming a protective cyst and lowering its metabolic rate, T. tubifex can survive drought and food shortage. Encystment may also function in the dispersal of the worm. They usually inhabit the bottom sediments of lakes, rivers, and occasionally sewer lines and outlets.[1]

References

Lake zones
Littoral zone
Limnetic zone
Profundal zone
Benthic zone
Lake stratification
Epilimnion
Metalimnion
Hypolimnion
Destratification
Lake types
Holomictic lake
   Monomictic lake
   Dimictic lake
   Polymictic lake
Meromictic lake
Amictic lake
Aquatic ecosystems
Wild fisheries
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!