Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (5000-20,000 square km (about 2000-8000 square miles)) This species occurs from Point Conception, California to Bahia de Tortuga, Baja California in Mexico (USFWS, 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Haliotis corrugata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 36 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTAGTCTTTTAATTCGAGCCGAACTTGGCCAACCAGGGGCACTTCTAGGAGAT---GACCAACTCTACAATGTAATTGTAACAGCTCACGCTTTCGTAATAATTTTCTTCCTAGTCATGCCACTAATAATCGGAGGATTTGGAAACTGATTAGTCCCCCTAATACTTGGTGCACCGGATATAGCTTTTCCCCGATTAAATAACATAAGATTCTGACTCCTTCCGCCATCCTTAACCTTACTCTTAACATCAGGCGCTGTAGAAAGCGGGGCAGGAACAGGCTGAACAGTCTACCCTCCCCTTTCTAGTAACCTTGCCCACGCAGGAGCATCAGTCGACCTTGCAATCTTCTCCCTACACCTAGCCGGAATCTCATCAATTTTAGGGGCAGTAAATTTTATCACTACAGTAATAAATATACGTGTAAAAGCACAACCTTTAGAACGAATACCATTATTTGTTTGATCCGTAAAAATTACTGCCATCTTACTTCTCTTATCACTACCTGTTCTAGCAGGTGCTATTACAATACTTTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Haliotis corrugata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: This species occurs from Point Conception, California to Bahia de Tortuga, Baja California in Mexico (USFWS, 2006), but is in serious decline due to overfishing.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: Survey data from 1991 to 2001 from one region of the fishery showed a dramatic decline in density (28%) and the current condition of the abalone stock is an example of an uncontrolled fishery (Morales-Bojorquez et al., 2008).

Global Long Term Trend: Decline of 30-50%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Of the 7 abalone species distributed along the west coast of the Baja California peninsula, Haliotis fulgens and Haliotis corrugata comprise approximately 98% of the total fishery landings (Morales-Bojorquez et al., 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Haliotis corrugata

The pink abalone, scientific name Haliotis corrugata, is a species of large edible sea snail, a marine gastropod mollusk in the family Haliotidae, the abalones.[2]

Contents

Subspecies

  • H. c. corrugata W. Wood, 1828 (synonyms: Haliotis diegoensis Orcutt, 1900; Haliotis nodosa Philippi, 1845)
  • H. c. oweni Talmadge, 1966 - synonym: Haliotis oweni Talmadge, 1966[1]

Distribution

Pink abalones can be found along the Pacific coast of North America from Point Conception, California to Bahia de Santa Maria, Baja California Sur, Mexico.[2]

Dorsal view of a shell of Haliotis corrugata

Description

The shell is thick and characterized by strong corrugations and is more circular than other American abalones. The two to four open respiratory apertures have edges that are strongly elevated above the surface of the shell. These holes collectively make up the selenizone, which forms as the shell grows. The epipodium is a “ruffle” of tissue along the side of the foot. The head and epipodial tentacles are black, but the epipodial fringes are a mottled black and white, with many tubercles on the surface and a lacy edge.

Ecology

Habitat

This species occupies sheltered waters at depths between 20 and 118 feet (6 - 36 m). They are herbivores, feeding on kelp and drifting algae.

Life cycle

Pink abalone have separate sexes and broadcast spawn from March to November. Maturity is reached at about 1.4 in (35 mm) length or three to four years. Lifespan is 30 years or more.

Predators

Predators of this species other than mankind are sea otters, sea stars, large fish, and octopus.

Diseases

Pink abalones are subject to a chronic, progressive and lethal disease: the Withering Syndrome or abalone wasting disease, leading to mass mortality.

Threats and conservation

Pink abalone are threatened by historic overharvesting, illegal harvest, withering abalone syndrome disease, and climate change. In 1996, the California Department of Fish and Game closed the commercial and recreational abalone fisheries in California, but populations continued to decline. California has a Abalone Recovery Management Plan to guide conservation efforts.

The pink abalone is a US National Marine Fisheries Service Species of Concern. Species of Concern are those species about which the National Oceanic and Atmospheric Administration, National Marine Fisheries Service has some concerns regarding status and threats, but for which insufficient information is available to indicate a need to list the species under the US Endangered Species Act.

Information regarding the status of pink abalone in Mexico is scant. A commercial fishery for pink abalone is still in place in Mexico and is managed by local cooperatives.

References

  1. ^ a b Rosenberg, G. (2010). Haliotis corrugata Wood, 1828. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=445308 on 2011-08-24
  2. ^ a b Oliver, A.P.H. (2004). Guide to Seashells of the World. Buffalo: Firefly Books. 18.
  • Geiger D.L. & Owen B. (2012) Abalone: Worldwide Haliotidae. Hackenheim: Conchbooks. viii + 361 pp. [29 February 2012] page(s): 77
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!