Physical Description

Type Information

Holotype for Haliotis fulgens walallensis Stearns, 1899
Catalog Number: USNM 98327
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): J. Rivers
Locality: Gualala, Mendocino County, California, United States, North Pacific Ocean
  • Holotype: Stearns, R. E. Proc. U.S. Natl. Mus. 12: 139-142.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Haliotis walallensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTCAGTCTTTTAATTCGGGCCGAACTTGGCCAGCCAGGGGCACTCTTGGGAGAC---GACCAACTCTATAACGTAATTGTAACAGCCCACGCTTTCGTAATAATCTTCTTCCTAGTCATACCACTGATAATTGGAGGATTTGGAAACTGACTAGTCCCTTTAATATTAGGGGCACCAGACATAGCCTTTCCCCGACTAAATAACATAAGATTCTGACTCCTTCCGCCATCCTTAACCCTACTCCTAACATCGGGCGCTGTAGAAAGGGGAGCAGGGACAGGCTGAACAGTCTATCCTCCCCTCTCTAGTAACCTTGCCCACGCAGGAGCATCAGTAGACTTAGCAATTTTCTCCCTACACCTAGCCGGAATCTCATCAATTTTAGGGGCAGTAAACTTTATTACTACAGTAATAAATATACGTGTAAAAGCACAGCCCCTAGAACGAATGCCATTATTTGTTTGATCAGTAAAAATTACCGCCATCCTACTACTCCTATCACTACCTGTTNTAGCAGGTGCCATTACAATA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Haliotis walallensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Haliotis walallensis

Haliotis walallensis, common name the flat abalone, is a species of sea snail, a marine gastropod mollusk in the family Haliotidae, the abalones.[1]

Contents

Description

The size of the shell reaches 120 mm.

Distribution

This marine species occurs in the Pacific Ocean from British Columbia to Southern California.

References

  1. ^ a b Haliotis walallensis Stearns, 1899.  Retrieved through: World Register of Marine Species on 9 April 2010.
  • Turgeon, D.D., et al. 1998. Common and scientific names of aquatic invertebrates of the United States and Canada. American Fisheries Society Special Publication 26 page(s): 57
  • Geiger D.L. & Poppe G.T. (2000). A Conchological Iconography: The family Haliotidae. Conchbooks, Hackenheim Germany. 135pp 83pl
  • Geiger D.L. & Owen B. (2012) Abalone: Worldwide Haliotidae. Hackenheim: Conchbooks. viii + 361 pp. page(s): 143
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!