Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Laver spire shells are small but important. They are food for many animals. Furthermore, their droppings glue sand and mud together, contributing to the stability of the sea floor. Laver spire shells can crawl and during high tide, even float. By making a slime bubble on the underside of the shell, they hang in an upside down position under the water surface and drift with the wind and waves.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

This snail is often found in extremely high densities; up to 300,000 individuals have been recorded per square metre (1). When covered by the tide, it floats upside down on the surface of the water on a 'raft' of mucus (2). When the tide has gone out, this snail often climbs up vertical objects in order to browse (1). It feeds on silt, fungi, and diatoms, which it scrapes from the sediment surface with the radula, a narrow structure in molluscs that bears teeth and is used to rasp food (2). When floating, the snail also feeds on particles that become trapped in the mucus raft (2). Breeding occurs in spring and autumn (1); the sexes are separate, and fertilisation occurs internally (2). Egg masses of 4-8 eggs are usually cemented onto the shells of other laver spire snails and become covered with a protective layer of sand grains (2). There is some dispute as to the biology of the larval stage; research has shown that the larvae are planktonic, whereas other researchers have found that there is no planktonic stage, and that the larvae live on the substrate (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The laver spire snail, also known as the mudsnail, has a small, spiralling shell, which is brown to yellow in colour. The snail is grey with spots of pigment (1), and the tentacles are pale with a dark patch towards the tips (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

 A small spiralling shell with six whorls. Up to 6 mm high but more typically around 4 mm. The shell is brown to yellow in colour. The body of the snail is a clear grey frequently with various pigment spots.Also known as the mud snail. Many synonyms have been used in the past but Peringia ulvae is the only one used recently. Hydrobia ulvae is now the standard usage although Peringia is often used as a sub-genus of Hydrobia. Hydrobia neglecta has a black 'v' mark near the tip of the tentacles.
 The taxonomy of the Gastropoda has been recently revised (see Ponder & Lindberg 1997, and Taylor 1996). Ponder & Lindberg (1997) suggest that Mesogastropoda should be included in a monophyletic clade, the Caenogastropoda.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

Widely distributed around all of the coasts of Britain. It is also found in north-west Europe (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 4250 specimens in 1 taxon.
Water temperature and chemistry ranges based on 14 samples.

Environmental ranges
  Depth range (m): -2 - 89
  Temperature range (°C): 6.832 - 10.480
  Nitrate (umol/L): 1.265 - 12.040
  Salinity (PPS): 7.618 - 33.398
  Oxygen (ml/l): 6.320 - 8.061
  Phosphate (umol/l): 0.326 - 0.653
  Silicate (umol/l): 3.323 - 11.134

Graphical representation

Depth range (m): -2 - 89

Temperature range (°C): 6.832 - 10.480

Nitrate (umol/L): 1.265 - 12.040

Salinity (PPS): 7.618 - 33.398

Oxygen (ml/l): 6.320 - 8.061

Phosphate (umol/l): 0.326 - 0.653

Silicate (umol/l): 3.323 - 11.134
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Typically found on muddy sand, in estuaries and salt marshes. Sometimes also in lagoons and other areas of reduced salinity. Frequently associated with seagrass beds. Highest densities found mid-tidally but has been recorded down to 100 m depth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is found on mudflats, muddy sand, in estuaries (2) and in saltmarshes (1); it is most common on the middle and upper parts of the shore (2), although it has been found at depths of 100 metres (1). It is often associated with sea-grass beds (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Hydrobia ulvae (Hydrobia ulvae mud snail) preys on:
phytoplankton
POM

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hydrobia ulvae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 45 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTATTTGGTATGTGATCTGGGTTAGTCGGTACGGCACTGAGTTTATTAATTCGTGCTGAATTGGGTCAGCCTGGTGCACTTTTAGGCGAT---GATCAGCTTTATAACGTAATTGTTACTGCTCATGCCTTTGTTATGATTTTTTTCCTTGTAATACCCATGATAATTGGTGGTTTTGGAAACTGGCTAGTACCACTAATACTTGGTGCTCCAGATATGGCTTTTCCTCGACTTAATAATATAAGTTTCTGACTTTTACCTCCTGCCTTATTACTATTACTTTCTTCGGCAGCTGTAGAGAGAGGGGCAGGGACAGGATGAACTGTCTATCCCCCACTTTCTAGCAATCTTGCTCATGCGGGAGGATCTGTAGACTTAGCTATTTTTTCTTTGCACTTAGCAGGTGTTTCTTCTATTCTTGGAGCCGTAAACTTTATTACAACTATTATCAATATACGATGACGAGGAATGCAGTTCGAACGGCTTCCGTTGTTTGTTTGATCTGTAAAAATTACTGCCATTTTATTATTATTATCACTACCTGTCTTGGCAGGTGCGATTACCATACTTTTAACGGATCGAAACTTTAATACTGCATTTTTTGATCCAGCGGGAGGTGGAGATCCTATCTTATAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hydrobia ulvae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 45
Specimens with Barcodes: 45
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Status

Common and widespread.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not currently threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

One of the major habitats supporting this species, mudflats, is a priority habitat under the UK Biodiversity Action Plan (UKBAP). It therefore has a conservation Action Plan. Many mudflats are protected by UK and European legislation, and have been designated as protected areas including Sites of Special Scientific Interest (SSSIs), Special Protection Areas (SPAs) and Special Areas of Conservation (SACs). Mudflats and sandflats are listed as an Annex 1 habitat under the EC Habitats Directive (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Hydrobia ulvae

Hydrobia ulvae, also known as Peringia ulvae,[3] common name the Laver spire shell or mudsnail, is an European species of very small aquatic snail with gills and an operculum, a gastropod mollusk in the family Hydrobiidae.[2]

This is arguably a marine snail, but it is often also listed as a non-marine species because it tolerates brackish water and lives in salt marshes and similar habitats.

When it is within the genus Peringia, this species is the type species of the genus Peringia.[4]

Distribution[edit]

This species occurs on the coasts of the Baltic Sea, the Eastern Atlantic and the western Mediterranean Sea,[3] including:

The type locality is "on the shores of Flintshire", Wales, United Kingdom.[1]

Shells of Hydrobia ulvae
The engraving of a shell of Hydrobia ulvae from its original description (1777) was very small

Description[edit]

This species was originally described by Welsh naturalist Thomas Pennant in 1777.[1] Pennant's original text (the type description) reads as follows:[1]

Ulvae.

T. with four spires, the first ventricose; of a deep brown color; aperture oval.
Size of a grain of wheat.
Tab. lxxxvi. fig. 120.
Inhabits Ulva Lactuca on the shores of Flintshire.

"T." is an abbreviated word testa from Latin language, that means "shell".

The shell is often heavily corroded, usually whitish with brown peristome present on the last whorl.[3] The shell has 5-7 very weakly convex whorls, that are regularly increasing but not always regularly rounded.[3] The lip is attached to the last whorl.[3]

The width of the shell is 2.5-3 mm.[3] The height of the shell is 4-5.5 mm.[3]

Habitat[edit]

A number of individuals of Hydrobia ulvae on mud

Hydrobia ulvae is a widespread and abundant member of the benthic fauna of estuarine habitats and coastal brackish and salt waters.[5][3] It is very common in brackish water and saltwater, in estuaries and salt marshes.[3] It is most common in the upper half of the intertidal zone.[3] It tolerates salinity 1.0-3.3 %.[3]

Hydrobia ulvae seems to prefer more exposed localities with less vegetation than Hydrobia ventrosa and Hydrobia neglecta.[3]

Hydrobia ulvae feeds on detritus and it also consumes seaweeds directly.[3]

It is pederictional dioecious with sexes being easily identified through dissection.[5] On the west coast of Wales this species has peaks of spawning activity in spring and autumn and produces planktotrophic larvae (veliger)[6] that remain in the plankton for up to four weeks before settlement.[5] This period of development affords the potential for dispersal to new habitats and mixing with geographically separate populations.[5] The species provides an interesting case for molecular analysis as the pelagic dispersal phase raises fascinating questions on gene flow, differentiation, recruitment, and inbreeding, but there remains the potential for self-recruitment of estuarine populations.[5]

One of its natural predators is the Arctic barrel-bubble (Retusa obtusa).[citation needed]

References[edit]

This article incorporates public domain text from references[3][1] and CC-BY-2.0 text from the reference[5]

  1. ^ a b c d e Pennant T. (1777). British zoology. Vol. IV. Crustacea. Mollusca. Testacea. pp. 1-3, iii-viii, 1-10, 1-154, Plates 1-93. London, White. page 132.
  2. ^ a b Gofas, S. (2010). Hydrobia ulvae (Pennant, 1777). In: Bouchet, P.; Gofas, S.; Rosenberg, G. (2010) World Marine Mollusca database. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=140126 on 2010-11-27.
  3. ^ a b c d e f g h i j k l m n o "Species summary for Peringia ulvae". AnimalBase, last modified 30 March 2009, accessed 16 September 2011.
  4. ^ "Genus summary for Peringia". AnimalBase, last modified 16 August 2006, accessed 16 September 2011.
  5. ^ a b c d e f Brownlow R. J., Dawson D. A., Horsburgh G. J., Bell J. J. & Fish J. D. (2008). "A method for genotype validation and primer assessment in heterozygote-deficient species, as demonstrated in the prosobranch mollusc Hydrobia ulvae". BMC Genetics 9: 55. doi:10.1186/1471-2156-9-55.
  6. ^ Fish J. D. & Fish S. (1977). "The veliger larva of Hydrobia ulvae with observations on the veliger of Littorina littorea (Mollusca: Prosobranchia)". Journal of Zoology 182(4): 495-503. doi:10.1111/j.1469-7998.1977.tb04165.x.

Further reading[edit]

  • Backeljau T. (1986). Lijst van de recente mariene mollusken van België [List of the recent marine molluscs of Belgium]. Koninklijk Belgisch Instituut voor Natuurwetenschappen: Brussels, Belgium. 106 pp.
  • Fish J. D., Fish S. & Foley H. (2000). "The biology of mud snails with particular reference to Hydrobia ulvae". In: British Saltmarshes. Sherwood B. R., Gardiner B. G. & Harris T. (eds.) London, Linnean Society: 165-179.
  • Gofas S., Le Renard J., Bouchet P. (2001). Mollusca, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 180-213.
  • Haase M. (1993). "The genetic differentiation in three species of the genus Hydrobia and systematic implications (Caenogastropoda, Hydrobiidae)". Malacologia 35: 389-398.
  • Muller Y. (2004). Faune et flore du littoral du Nord, du Pas-de-Calais et de la Belgique: inventaire. [Coastal fauna and flora of the Nord, Pas-de-Calais and Belgium: inventory]. Commission Régionale de Biologie Région Nord Pas-de-Calais: France. 307 pp.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!