Overview

Brief Summary

Biology

These and some other Australian ants (the 'bulldog ants (Myrmeciinae)) belong to an ancient linage and have simpler social systems than other modern ants (5). Mature Nothomyrmecia colonies are generally small at 50 - 120 adults (2). The newly mated queens initiate colony foundation in groups of 2 or 3; the dominant female subsequently evicts the subordinate individuals from the nest once the first workers appear (4). The workers of the colony tend the brood and actively hunt for food on trees near the nests. They use their stings to stun prey, such as other invertebrates, which are returned without dissection (5). Unlike most species of ants, Nothomyrmecia workers are able to tolerate low temperatures and tend to forage after dusk when temperatures have dropped to 5 - 10 °C (2). It is thought that the low temperatures may assist foraging, making prey slower and therefore less likely to escape (2). Workers navigate between the nests and forage trees by using the silhouette of the tree canopy like a map (4). The most significant and unique primitive features of Nothomyrmecia are behavioural (5). Unlike all other studied ants, there is virtually no evidence of worker division of labour within the nests, although some individuals spend extended periods near the queen, and some may act as guards within the nest entrances for up to several days (5). Field experiments involving the marking of foragers and later excavation of subject colonies, show that all but one or two workers may leave the nest to forage over a period of only 2 or 3 nights; the exceptions are believed to be the entrance guards (5). Thus the most elementary and minimal level of task specialisation seen in other ants (that between foragers and in-nest specialists) is absent. Otherwise the workers forage alone and show no evidence of cooperative behaviour, apart from living together in the nest (5). Nothomyrmecia has been referred to as the 'least sociable' of all ants (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This ant of ancient lineage is described as a 'living fossil.' It is perhaps the most 'primitive' ant still alive today (2). Ants are social insects, which typically live in colonies within nests comprising a single reproductive 'queen' and a force of non-reproductive 'workers', of whom the queen is the mother. Unlike the workers, virgin queens possess wings that are used only once for flight in a mating swarm, following which the wings are shed and the now fertilised queens begin colony foundation, typically alone (5). Seasonally, nests include immatures: eggs, larvae and pupae. Males, which are winged and develop from unfertilised eggs, are present only periodically each year, prior to the breeding season (5). The individual workers typically perform different roles; a characteristic known as 'polyethism' or 'division of labour' (5). Minimally, there are individuals specialised as foragers, working outside the nests, and others, which seldom leave the nests but perform in-nest activities, such as brood care. In advanced species these worker 'castes' may be physically differentiated, often including large-headed 'soldiers' (5). Nothomyrmecia workers are pale yellow in colour and have large eyes, distinctively long mandibles and a powerful sting (3); there is no soldier caste (5). Unusually, the queens have extremely reduced wings that are unlikely to be functional for flight (2). Virgin queens probably mate with flying males on tree trunks or the ground; the function of the reduced wings is not known (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Taxonomic History

Nothomyrmecia macrops Clark, 1934a PDF: 19, fig. 1 (w.) AUSTRALIA. AntCat AntWiki

Taxonomic history

Taylor, 1978a PDF: 979 (q.m.); Wheeler, Wheeler & Taylor, 1980 PDF: 131 (l.); Imai, Taylor, et al. 1991: 133 (k.).
See also: Jaisson, Fresnau, et al. 1992: 425; Hölldobler & Taylor, 1983: 382; Ward & Taylor, 1981 PDF: 177.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Originally known from extreme southern Western Australia, this species was thought to be extinct until it was rediscovered near Poochera in South Australia in 1977 (4). Its known range has been recently extended to other areas of southwestern South Australia (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Colonies inhabit nests excavated in the soil (3), beneath eucalyptus trees (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nothomyrmecia macrops

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTATAATTGGAGGATTTGGAAATTTTTTAGTTCCACTTATACTAGGAGCCCCTGATATAGCTTACCCTCGAATAAATAACTTAAGATTCTGACTTCTACCTCCATCTATCACTTTACTAATCCTAAGAAATTTTATCAGAAATGGAACAGGAACTGGATGAACAATTTACCCTCCTTTAGCATCAAATATTTTTCATAGAGGACCTTCAATTGACCTAACAATCTTTTCCCTTCATATTGCAGGAATATCTTCTATTCTTGGAGCTATTAATTTTATCTCAACAATTATTAACATATATAATAAAAATATATCAATAGACAAAATCCCTTTACTAGTATGAGCAATTCTTATTACCGCTATTCTTCTATTATTAGCCCTCCCCGTCTTAGCAGGAGCAATTACTATACTTTTAACTGATCGAAACTTAAATACATCTTTTTTTGATCCTTCTGGAGGAGGGGACCCAATTTTATACCAACACTTATTTTGATTTTTTGGTCATCCTGAAGTATATATTCTAATTCTCCCAGGATTTGGTCTAATTTCTCATATTATTATAAGAGAAAGAGGAAAAAAAGAAACATTTGGATCTCTAAGAATAATTTATGCAATAACAGCTATTGGATTCCTAGGTTTCATTGTTTGAGCTCATCACATATTTACAATTGGCCTAGACGTTGACACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nothomyrmecia macrops

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
B1+2c

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Social Insects Specialist Group

Reviewer/s

Contributor/s

History
  • 1994
    Insufficiently Known
    (Groombridge 1994)
  • 1990
    Insufficiently Known
    (IUCN 1990)
  • 1988
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Critically Endangered (CR - B1+2c) on the IUCN Red List 2002 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

This species has a restricted distribution, and is known only from a small number of sites. Nothomyrmecia is closely associated with eucalyptus trees and is therefore extremely vulnerable to their removal or damage by fire. An underground telephone line was installed at the famous rediscovery site near Poochera, and this led to the almost complete destruction of the then only known population (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

No conservation measures are currently in place.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Nothomyrmecia

Nothomyrmecia macrops, sometimes called the dinosaur ant or dawn ant,[2] is the only extant species of its genus. Its morphological similarity with the Baltic Eocene fossil ant genus Prionomyrmex has resulted in the species often being considered a living fossil and stimulated several studies on its morphology, behavior, ecology, and chromosomes.

Habitat[edit]

It is found in the cool regions of the mallee of southern South Australia and Western Australia in old-growth areas populated with various Eucalyptus species.[3] These ants were of special interest to entomologists since their similarity with the Eocene Baltic fossil Prionomyrmex was thought to offer a chance to observe and study "primitive" ant social organization. However, N. macrops is known to possess some behavioural habits of more advanced ant species, and morphological[4] and molecular[5] phylogenies of the ants indicate that other ant lineages such as Ponerinae are more properly considered "primitive" within the family.

Discovery[edit]

Nothomyrmecia was originally discovered in 1931 near Balladonia in Western Australia. At the time it was thought to be living proof that ants had evolved from wasps. However the amateur naturalists who discovered the species had failed to record collection sites, so no other specimens could be found in the area. In 1977 a solitary worker ant from the species was found by Dr. Bob Taylor and his party of entomologists from Canberra at Poochera, 1300 km (800 mi) from the site of the 1931 discovery. A further colony was found at Penong, 180 km (110 mi) to the west of Poochera, but the fate of the colony discovered in 1931 is not known.[6]

Relationships[edit]

Nothomyrmecia was described in 1934 by Clark [7] as a new genus of Myrmeciinae, though with some hesitation due to its apparent similarity with the Eocene Baltic amber fossil Prionomyrmex unknown to him and of which remained only literature descriptions and figures. In 1951 Clark [8] proposed a new ant subfamily for his Nothomyrmecia, based on morphological differences with the other Myrmeciinae. Clark’s placement of Nothomyrmecia in isolated position within the ants was confirmed by Taylor’s rediscovery of this species in 1977 [9] and was universally accepted by the scientific community until 2003. In 1998, Baroni Urbani described a new Baltic fossil Prionomyrmex species. After examining specimens of N. macrops, Baroni Urbani stated that his new species and N. macrops belonged to the same genus, in which case the name Prionomyrmex would replace the name Nothomyrmecia and the subfamily Nothomyrmeciinae must be called Prionomyrmeciinae.[10] Dlussky & Perfilieva in 2003 [11] separated again Nothomyrmecia from Prionomyrmex on the base of the fusion of an abdominal segment. In the same year Ward & Brady,[12] using a different, broader set of characters, reached the same conclusion as Dlussky and Perfileeva [11] and, in addition, transferred both Nothomyrmecia and Prionomyrmex as distinct genera in the older subfamily Myrmeciinae. Later on, Dlussky [13] also refers only to Ward & Brady’s classification.[12] However, Baroni Urbani (2005, 2008),[14][15] suggested additional evidence in favor of his former interpretation and pretended the fallacy of Ward and Brady’s[12] arguments. His views are not addressed in relevant papers, which continue to favor the classification of Ward and Brady.[5][16][17]

References[edit]

  1. ^ Social Insects Specialist Group (1996). "Nothomyrmecia macrops". IUCN Red List of Threatened Species. Version 2.3. International Union for Conservation of Nature. Retrieved September 22, 2011. 
  2. ^ Edward O. Wilson and Bert Hölldobler. "The rise of the ants: phylogenetic and ecological explanation". PNAS. Retrieved 6 April 2013. 
  3. ^ Threatened Species Scientific Committee. "Dinosaur Ant, Fossil Ant (Nothomyrmecia macrops)". Department of Sustainability, Environment, Water, Population and Communities. Retrieved 15 August 2010. 
  4. ^ C. Baroni Urbani, B. Bolton & P. S. Ward (1992). "The internal phylogeny of ants (Hymenoptera: Formicidae)". Systematic Entomology 17: 301–329. 
  5. ^ a b Philip S. Ward (2007). "Phylogeny, classification, and species-level taxonomy of ants (Hymenoptera: Formicidae)". Zootaxa 1668: 549–563. 
  6. ^ Poochera travel guide from Nullarbor Net, accessed 22 April 2007
  7. ^ J. Clark (1934). "Notes on Australian ants, with descriptions of new species amd a new genus". Memoirs of the National Museum of Victoria 8: 5–20. 
  8. ^ J. Clark (1951). "The Formicidae of Australia. 1. Subfamily Mrmeciinae". CSIRO, Melbourne: 230 p. 
  9. ^ J. Taylor (1977). "Nothomyrmecia macrops: a living-fossil ant rediscovered". Science 201: 979–285. 
  10. ^ C. Baroni Urbani (2000). "Rediscovery of the Baltic amber ant genus Prionomyrmex (Hymenoptera, Formicidae) and its taxonomic consequences". Eclogae Geologicae Helvetiae 93: 471–480. 
  11. ^ a b G. M. Dlussky & K. S. Perfilieva (2003). "Paleogene ants of the genus Archimyrmex Cockerell, 1923 (Hymenoptera, Formicidae, Myrmeciinae)". Paleontological Journal 37: 39–47. 
  12. ^ a b c P. S. Ward & S. G. Brady (2003). "Phylogeny and biogeography of the ant subfamily Myrmeciinae (Hymenoptera: Formicidae)". Invertebrate Systematics 17: 361–386. doi:10.1071/IS02046. 
  13. ^ G. M. Dlussky (2012). "New fossil ants of the subfamily Myrmeciinae (Hymenoptera, Formicidae) from Germany". Paleontological Journal 46: 288–292. 
  14. ^ C. Baroni Urbani (2005). "Phylogeny and biogeography of the ant subfamily Prionomyrmecinae (Hymenoptera, Formicidae". Annali del Museo Civico di Storia Naturale „G. Doria" 96: 581–595. 
  15. ^ C. Baroni Urbani (2008). "Orthotaxonomy and parataxonomy of true and presumed bulldog ants". Doriana. 8 (358): 1–10. 
  16. ^ E. O. Wilson & B. Hölldobler (2005). "The rise of the ants: A phylogenetic and ecological explanation". Proceedings of the National Academy of Sciences of the United States of America 102: 7411–7414. 
  17. ^ C. S. Moreau, C. D. Bell & R. Vila (2006). "Phylogeny of the ants: diversification in the age of angiosperms". Science 312: 301–304. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!