Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Truncatella pulchella (Deposit-feeding gastropods) is prey of:
Nemertines
Nereidae
Hesionidae
Glyceridae
Onuphidae
Odostomia seminuda
Acanthocitona pygmaea
Hylina veliei
Spirals
Nudibranchia
Polinices
Terebra
Seila adamsi
Epitonium albidum
Opalia hotessieriana
Natica pusilla
Urosalpinx perrugata
Busycon spiratum
Marginella aureocincta
Marginella apicina
Marginella bella
Turbonilla dalli
Turbonilla hemphilli
Anas discors
Bucephala albeaola
Rallus longirostris
Charadrius semipalmatus
sediment POC
Pinixia floridana
Neopanope texana
Processa bermudiensis
Penaeus duoarum
Palaemonetes floridanus

Based on studies in:
USA: Florida (Estuarine)

This list may not be complete but is based on published studies.
  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Truncatella pulchella (Deposit-feeding gastropods) preys on:
algae
bacteria
Microfauna
meiofauna

Based on studies in:
USA: Florida (Estuarine)

This list may not be complete but is based on published studies.
  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Truncatella pulchella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTGTTTGGAATGTGGTCTGGTCTTGTTGGAACTGCATTAAGTTTATTAATTCGAGCTGAATTAGGCCAACCGGGTGCTCTCTTAGGTGAC---GATCAACTTTATAATGTAATTGTCACGGCTCACGCTTTTGTAATAATTTTTTTCTTAGTTATACCAATAATAATTGGTGGTTTTGGAAACTGATTAGTTCCGTTAATATTAGGGGCTCCAGATATGGCATTTCCTCGATTAAATAACATAAGATTTTGATTACTTCCTCCCGCTTTATTATTGCTTCTTTCTTCTGCGGGCGTAGAAAGAGGAGCTGGTACAGGATGAACTGTATATCCACCATTGGCCGCTAATTTGGCCCATGCCGGAGGATCAGTAGATTTAGCCATTTTTTCTCTCCATTTAGCGGGTGTTTCTTCGATTTTAGGTGCTGTAAATTTTATTACTACTATCATTAATATACGATGACGAGGTATGCAGTTTGAGCGGCTTCCTTTATTTGTATGATCTGTAAAAATTACAGCTATTTTATTATTGCTTTCATTACCAGTGTTAGCTGGTGCAATTACTATGCTCTTAACTGATCGAAATTTTAATACGGCTTTTTTTGACCCTGCTGGAGGTGGAGATCCTATTCTTTATCAGCATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Truncatella pulchella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Truncatella pulchella

Truncatella pulchella is a species of very small land snail that lives at the edge of the sea, a gastropod mollusk in the family Truncatellidae. This species lives on coastlines in the tropical western Atlantic.

Contents

Distribution

The distribution of this species includes: [1]

Description

The maximum recorded shell length is 6.5 mm.[2]

Habitat

The minimum recorded depth for this species is 0 m, and the maximum recorded depth is 0 m.[2]

References

  1. ^ Walker B. (1928). "The terrestrial shell-bearing mollusca of Alabama". Univ. Mich. Mus. Zool. Misc. Pub. 18, 180 pp. (as Truncatella bilabiata)
  2. ^ a b Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!