Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Truncatella pulchella (Deposit-feeding gastropods) preys on:
algae
bacteria
Microfauna
meiofauna

Based on studies in:
USA: Florida (Estuarine)

This list may not be complete but is based on published studies.
  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Truncatella pulchella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTGTTTGGAATGTGGTCTGGTCTTGTTGGAACTGCATTAAGTTTATTAATTCGAGCTGAATTAGGCCAACCGGGTGCTCTCTTAGGTGAC---GATCAACTTTATAATGTAATTGTCACGGCTCACGCTTTTGTAATAATTTTTTTCTTAGTTATACCAATAATAATTGGTGGTTTTGGAAACTGATTAGTTCCGTTAATATTAGGGGCTCCAGATATGGCATTTCCTCGATTAAATAACATAAGATTTTGATTACTTCCTCCCGCTTTATTATTGCTTCTTTCTTCTGCGGGCGTAGAAAGAGGAGCTGGTACAGGATGAACTGTATATCCACCATTGGCCGCTAATTTGGCCCATGCCGGAGGATCAGTAGATTTAGCCATTTTTTCTCTCCATTTAGCGGGTGTTTCTTCGATTTTAGGTGCTGTAAATTTTATTACTACTATCATTAATATACGATGACGAGGTATGCAGTTTGAGCGGCTTCCTTTATTTGTATGATCTGTAAAAATTACAGCTATTTTATTATTGCTTTCATTACCAGTGTTAGCTGGTGCAATTACTATGCTCTTAACTGATCGAAATTTTAATACGGCTTTTTTTGACCCTGCTGGAGGTGGAGATCCTATTCTTTATCAGCATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Truncatella pulchella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Truncatella pulchella

Truncatella pulchella is a species of very small land snail that lives at the edge of the sea, a gastropod mollusk in the family Truncatellidae. This species lives on coastlines in the tropical western Atlantic.

Contents

Distribution

The distribution of this species includes: [1]

Description

The maximum recorded shell length is 6.5 mm.[2]

Habitat

The minimum recorded depth for this species is 0 m, and the maximum recorded depth is 0 m.[2]

References

  1. ^ Walker B. (1928). "The terrestrial shell-bearing mollusca of Alabama". Univ. Mich. Mus. Zool. Misc. Pub. 18, 180 pp. (as Truncatella bilabiata)
  2. ^ a b Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!