Overview

Comprehensive Description

Description

 A small topshell (up to 1.5 cm high and 1.7 cm across), it is bluntly conical with a oval-shaped umbilicus. The umbilicus appears as a small but deep hole on the underside of the shell. The shell has five or six whorls. It is grey to light yellowish in colour, with broad stripes of reddish-brown to purple. The apex is sometimes eroded and silvery.In Latin 'Gibber' means hump ('-ula' is a diminutive suffix), and 'Cineraria' means related to ashes, hence 'ash coloured hump'. In Devon and Cornwall, the umbilicus may be covered by the inner lip.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Fretter and Graham (1977) stated that this species does not occurs at the coasts of Belgium and the Netherlands. This statement is incorrect according to Backeljau and Vanwalleghem (in litt.) and Haelters & Kerckhof (2003).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 519 specimens in 1 taxon.
Water temperature and chemistry ranges based on 92 samples.

Environmental ranges
  Depth range (m): 0 - 59
  Temperature range (°C): 9.788 - 12.348
  Nitrate (umol/L): 2.853 - 8.324
  Salinity (PPS): 34.218 - 35.363
  Oxygen (ml/l): 6.013 - 6.665
  Phosphate (umol/l): 0.333 - 0.626
  Silicate (umol/l): 2.311 - 5.019

Graphical representation

Depth range (m): 0 - 59

Temperature range (°C): 9.788 - 12.348

Nitrate (umol/L): 2.853 - 8.324

Salinity (PPS): 34.218 - 35.363

Oxygen (ml/l): 6.013 - 6.665

Phosphate (umol/l): 0.333 - 0.626

Silicate (umol/l): 2.311 - 5.019
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 It is found on the lower levels of rocky shores on weed and under stones to a depth of 130 m sublittorally. It is sometimes found in rock pools higher on the shore.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gibbula cineraria

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACCCTTTACTTAATTTTTGGGATCTGATCTGGGCTTGTAGGGACCGCTCTTAGTCTACTAATTCGTGCTGAATTAGGACAACCAGGAGCCCTCCTTGGAGAC---GACCAATTATACAATGTAATTGTAACAGCTCATGCTTTTGTAATAATTTTCTTCTTAGTCATACCTTTAATAATTGGTGGGTTCGGAAATTGATTAATTCCTTTAATACTGGGGGCACCTGACATGGCTTTCCCTCGACTAAATAACATAAGTTTTTGACTACTTCCTCCCTCCTTGACCCTATTACTAGCCTCCTCAGCTGTAGAAAGAGGGGTTGGTACGGGATGAACGGTTTATCCTCCACTTTCAGGTAATTTGGCTCATGCTGGTGCCTCAGTTGACCTGGCTATTTTCTCCCTTCACTTAGCGGGTGTTTCTTCTATTTTAGGGGCCGCAAATTTTATTACTACAGTGATTAATATACGATGACAAGGAATGAAGTTTGAGCGATTGCCTTTGTTTGTCTGGTCTGTAAAAATTACTGCTATTTTACTCTTGCTATCACTCCCAGTCCTAGCCGGTGCTATTACTATGCTGCTCACTGATCGAAATTTTAATACTTCGTTCTTTGACCCAGCAGGAGGGGGAGACCCAATTCTTTACCAGCATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gibbula cineraria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Gibbula cineraria

Gibbula cineraria is a species of small sea snail, a marine gastropod mollusc in the family Trochidae, the top snails. [1]

Description[edit]

The size of the shell varies between 12 mm and 18 mm. The thick, narrowly umbilicate, rarely imperforate shell has a conical, thick shape. It is cinereous, densely marked with numerous narrow longitudinal brown or reddish lines, or broader stripes. The 6 whorls are flattened, with 7 or 8 thread-like spiral ridges on the upper surface of the body whorl, with often one or two finer striae between each ridge, and about a dozen fine ridge-like striae on the under side. The body whorl is angulate at the periphery, somewhat convex beneath. The aperture is subrhomboidal and smooth within. The columella is straightened in the middle. The umbilicus is narrow. [2]

Distribution[edit]

This species occurs in the North Sea, the Mediterranean Sea and in the Northern Atlantic Ocean (Azores, Canary Islands, Morocco)

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!