Overview
Comprehensive Description
Description
A small topshell (up to 1.5 cm high and 1.7 cm across), it is bluntly conical with a oval-shaped umbilicus. The umbilicus appears as a small but deep hole on the underside of the shell. The shell has five or six whorls. It is grey to light yellowish in colour, with broad stripes of reddish-brown to purple. The apex is sometimes eroded and silvery.In Latin 'Gibber' means hump ('-ula' is a diminutive suffix), and 'Cineraria' means related to ashes, hence 'ash coloured hump'. In Devon and Cornwall, the umbilicus may be covered by the inner lip.
© The Marine Biological Association of the United Kingdom
Source:
Marine Life Information Network
Trusted
Distribution
Azores, Belgian Exclusive Economic Zone, British Isles, Canaries, Channel Islands, De Haan, De Panne, Dutch Exclusive Economic Zone, European waters (ERMS scope), German Bight, Goote Bank, Irish Exclusive economic Zone, Malta, Mediterranean Sea, Norwegian Exclusive Economic Zone, Oostende, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, West Coast of Norway , Wimereux
-
Eneman, E. (1984). Uit het Natuurhistorisch Archief [From the Natural History Archive]. De Strandvlo 4(1): 4-17
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=755
-
Müller, Y. (2004). Faune et flore du littoral du Nord, du Pas-de-Calais et de la Belgique: inventaire. [Coastal fauna and flora of the Nord, Pas-de-Calais and Belgium: inventory]. Commission Régionale de Biologie Région Nord Pas-de-Calais: France. 307 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9269
-
Hayward, P.J.; Ryland, J.S. (Ed.) (1990). The marine fauna of the British Isles and North-West Europe: 1. Introduction and protozoans to arthropods. Clarendon Press: Oxford, UK. ISBN 0-19-857356-1. 627 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1
-
Christie, H.; Jørgensen, N.M.; Norderhaug, K.M.; Waage-Nielsen, E. (2003). Species distribution and habitat exploitation of fauna associated with kelp (Laminaria hyperborea) along the Norwegian Coast. J. Mar. Biol. Ass. U.K. 83(4): 687-699
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1291
-
Backeljau, T. (1986). Lijst van de recente mariene mollusken van België [List of the recent marine molluscs of Belgium]. Koninklijk Belgisch Instituut voor Natuurwetenschappen: Brussels, Belgium. 106 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2
-
de Bruyne, R.H. (1991). Schelpen van de Nederlandse kust [Shells of the Dutch coast]. Jeugdbondsuitgeverij/KNNV Uitgeverij: Utrecht, The Netherlands. ISBN 90-5107-017-9. III, 165 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=705
-
d'Udekem d'Acoz, C. (1990). Notes on some organisms collected between Wenduine and De Haan on 3 March 1990 [Notes sur quelques organismes recueillis entre Wenduine et De Haan le 3 mars 1990]. De Strandvlo 10(3): 74-78
http://www.marinespecies.org/ophiuroidea/aphia.php?p=sourcedetails&id=138631
-
Dumoulin, E. (1989). Micromolluscs in sand suppletions from the Goote Bank [Micromollusken uit opgespoten zand afkomstig van de Goote Bank]. De Strandvlo 9(1): 21-31
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=138713
-
Gofas, S.; Le Renard, J.; Bouchet, P. (2001). Mollusca, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 180-213
http://www.marinespecies.org/mollusca/aphia.php?p=sourcedetails&id=1364
-
Ziegelmeier, E. (1966). Die Schnecken (Gastropoda Prosobranchia) der deutsche Meeresgebiete und brackigen Küstengewässer [The Gastropoda Prosobranchia from the German seas and brackish coastal waters]. Helgol. Wiss. Meeresunters. 13: 1-66 [Subsequent publication]
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1678
-
Leloup, E. (1937). Contributions à l’étude de la faune belge: 8. Les dégâts causés par le ver polychète Polydora ciliata (Johnston) dans les coquilles des bigorneaux et des huîtres [Contributions to the study of the Belgian fauna: 8. The damage caused by the worm Polydora ciliata (Johnston) in the shells of periwinkles and oysters]. Med. K. Belg. Inst. Nat. Wet. 13(33): 1-4
http://www.marinespecies.org/mollusca/aphia.php?p=sourcedetails&id=1593
-
MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=149081
-
Guiry, M.D. & Guiry, G.M. (2011). Species.ie version 1.0 World-wide electronic publication, National University of Ireland, Galway (version of 15 March 2010).
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=149068
-
Ramos, M. (ed.). 2010. IBERFAUNA. The Iberian Fauna Databank
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=149024
-
Dyntaxa (2013) Swedish Taxonomic Database. Accessed at www.dyntaxa.se [15-01-2013].
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=165516
-
Sciberras, M.; Schembri, P.J. (2007). A critical review of records of alien marine species from the Maltese Islands and surrounding waters (Central Mediterranean) Medit. Mar. Sci. 8(1): 41-66
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=165389
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Fretter and Graham (1977) stated that this species does not occurs at the coasts of Belgium and the Netherlands. This statement is incorrect according to Backeljau and Vanwalleghem (in litt.) and Haelters & Kerckhof (2003).
-
Backeljau, T. (1986). Lijst van de recente mariene mollusken van België [List of the recent marine molluscs of Belgium]. Koninklijk Belgisch Instituut voor Natuurwetenschappen: Brussels, Belgium. 106 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2
-
Haelters, J.; Kerckhof, F. (2003). Asgrauwe tolhoren Gibbula cineraria (L., 1758) levend voorkomend in Belgische wateren. De Strandvlo 23(1): 26-27
http://www.marinespecies.org/mollusca/aphia.php?p=sourcedetails&id=142191
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Ecology
Habitat
Depth range based on 519 specimens in 1 taxon.
Water temperature and chemistry ranges based on 92 samples.
Environmental ranges
Depth range (m): 0 - 59
Temperature range (°C): 9.788 - 12.348
Nitrate (umol/L): 2.853 - 8.324
Salinity (PPS): 34.218 - 35.363
Oxygen (ml/l): 6.013 - 6.665
Phosphate (umol/l): 0.333 - 0.626
Silicate (umol/l): 2.311 - 5.019
Graphical representation
Depth range (m): 0 - 59
Temperature range (°C): 9.788 - 12.348
Nitrate (umol/L): 2.853 - 8.324
Salinity (PPS): 34.218 - 35.363
Oxygen (ml/l): 6.013 - 6.665
Phosphate (umol/l): 0.333 - 0.626
Silicate (umol/l): 2.311 - 5.019
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 92 samples.
Environmental ranges
Depth range (m): 0 - 59
Temperature range (°C): 9.788 - 12.348
Nitrate (umol/L): 2.853 - 8.324
Salinity (PPS): 34.218 - 35.363
Oxygen (ml/l): 6.013 - 6.665
Phosphate (umol/l): 0.333 - 0.626
Silicate (umol/l): 2.311 - 5.019
Graphical representation
Depth range (m): 0 - 59
Temperature range (°C): 9.788 - 12.348
Nitrate (umol/L): 2.853 - 8.324
Salinity (PPS): 34.218 - 35.363
Oxygen (ml/l): 6.013 - 6.665
Phosphate (umol/l): 0.333 - 0.626
Silicate (umol/l): 2.311 - 5.019
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
It is found on the lower levels of rocky shores on weed and under stones to a depth of 130 m sublittorally. It is sometimes found in rock pools higher on the shore.
© The Marine Biological Association of the United Kingdom
Source:
Marine Life Information Network
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Gibbula cineraria
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
ACCCTTTACTTAATTTTTGGGATCTGATCTGGGCTTGTAGGGACCGCTCTTAGTCTACTAATTCGTGCTGAATTAGGACAACCAGGAGCCCTCCTTGGAGAC---GACCAATTATACAATGTAATTGTAACAGCTCATGCTTTTGTAATAATTTTCTTCTTAGTCATACCTTTAATAATTGGTGGGTTCGGAAATTGATTAATTCCTTTAATACTGGGGGCACCTGACATGGCTTTCCCTCGACTAAATAACATAAGTTTTTGACTACTTCCTCCCTCCTTGACCCTATTACTAGCCTCCTCAGCTGTAGAAAGAGGGGTTGGTACGGGATGAACGGTTTATCCTCCACTTTCAGGTAATTTGGCTCATGCTGGTGCCTCAGTTGACCTGGCTATTTTCTCCCTTCACTTAGCGGGTGTTTCTTCTATTTTAGGGGCCGCAAATTTTATTACTACAGTGATTAATATACGATGACAAGGAATGAAGTTTGAGCGATTGCCTTTGTTTGTCTGGTCTGTAAAAATTACTGCTATTTTACTCTTGCTATCACTCCCAGTCCTAGCCGGTGCTATTACTATGCTGCTCACTGATCGAAATTTTAATACTTCGTTCTTTGACCCAGCAGGAGGGGGAGACCCAATTCTTTACCAGCATTTATTT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Gibbula cineraria
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Wikipedia
Gibbula cineraria
Gibbula cineraria is a species of small sea snail, a marine gastropod mollusc in the family Trochidae, the top snails.
References
- Backeljau, T. (1986). Lijst van de recente mariene mollusken van België [List of the recent marine molluscs of Belgium]. Koninklijk Belgisch Instituut voor Natuurwetenschappen: Brussels, Belgium. 106 pp.
- Gofas, S.; Le Renard, J.; Bouchet, P. (2001). Mollusca, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 180-213
- Muller, Y. (2004). Faune et flore du littoral du Nord, du Pas-de-Calais et de la Belgique: inventaire. [Coastal fauna and flora of the Nord, Pas-de-Calais and Belgium: inventory]. Commission Régionale de Biologie Région Nord Pas-de-Calais: France. 307 pp.
 | Wikimedia Commons has media related to: Gibbula cineraria |
 | This Trochidae-related article is a stub. You can help Wikipedia by expanding it. |
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
