You are viewing this Species as classified by:

Overview

Brief Summary

Taxonomy

Up to ten Littoraria species can occur together in a single mangrove forest in the most diverse parts of the Indo-Pacific region, as at Singapore, and discrimination of the species can be difficult. Until 1986, when the taxonomy of the group was revised, most of these similar species of mangrove periwinkles were included under the name ‘Littorina scabra’. The wide, white columella of Littoraria scabra provides one of the best means of distinguishing this species from other similar members of Littoraria, which may have a wide columella that is purplish or brown, or alternatively a much narrower columella.The most reliable character for the identification of Littoraria species is the shape of the penis in males. This is a forked structure located on the right side of the neck of the animal, and bears a single sucker-like gland and an elongate filament for transmission of sperm. In L. scabra the glandular limb is larger than that carrying the filament. It is believed that the penis is a species-recognition character that is used by the females to distinguish members of their own species, explaining why each species has a unique penial shape.A molecular phylogeny (constructed from 28S rRNA, 12S rRNA and COI gene sequences) is available for 37 of the 39 members of the genus Littoraria, and this shows that L. scabra is a member of the subgenus Littorinopsis, and within this belongs to a clade that includes L. pallescens, L. philippiana and L. angulifera.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Introduction

Littoraria scabra is a marine snail belonging to the family of periwinkles (Littorinidae) and lives on mangrove trees in the tropical Indian and Pacific Oceans.The animal is edible and gathered for for food in some indigenous communities, but in general the small size, and the gritty texture of females carrying larvae, make this an unpopular shellfish.This species is not endangered at present, but is threatened by widespread destruction of mangrove forests.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Sexes are separate. During copulation the male mounts the shell of the female and inserts the penis under the lip of her shell and into the pallial oviduct. Mating may last for several hours. Sperm are transferred to the copulatory bursa, and later pass to another storage sac, the seminal receptacle, where they can survive for many months. Females spawn several thousand fertilized eggs in a short period, and retain these within the mantle cavity where they are attached in a thin layer to the folds of the reduced gills.Larvae hatch after several days as early veligers and are released simultaneously when the female descends the tree to reach the water level. Normal planktotrophic development follows, lasting an estimated 8 to 10 weeks. The length of the larval shell (protoconch) at settlement is about 0.32 to 0.42 mm. The combination of ovoviviparity and planktotrophic development is unusual in molluscs, but is characteristic of all members of the subgenus Littorinopsis. It is believed to be an adaptation to permit rapid release of larvae, thus minimising the time spent at the water surface where the female is vulnerable to aquatic predators.Females spawn probably once a month, in a lunar cycle, and at least in Queensland, Australia, the breeding season lasts throughout the year.Growth is rapid, reaching a shell length of 20 mm in about 8 months, and is slightly faster in females, giving rise to a small dimorphism in size. Males mature at about 16 mm, and females at 20 mm. Maximum lifespan is about 2 years. These data are from a population in northern Queensland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

This species is very widespread throughout the tropical regions of the Indian and western Pacific Oceans. It occurs from South Africa to the Red Sea, India, Malaysia, Australia, southern Japan, Hawaii and Polynesia.The typical habitat of L. scabra is the trunks, prop roots and lower branches of mangrove trees (mainly Rhizophora species, but also Avicennia and others), up to a height of 3m. The species avoids mangrove swamps that are very muddy or estuarine, and instead is most common on trees in relatively clear-water situations, on islands and promontories, or only on the outer seaward fringes of broad mangrove forests on continental coastlines. Where it is common, up to 20 individuals can be found on a single mangrove tree. Occasionally individuals can be found on driftwood on sandy beaches, or even on rocks in very sheltered situations.The snails graze on the surface of the bark of the mangrove trees, ingesting cork cells, fungal hyphae and diatoms.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 8 specimens in 2 taxa.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 1 - 5
  Temperature range (°C): 29.241 - 29.241
  Nitrate (umol/L): 0.806 - 0.806
  Salinity (PPS): 33.706 - 33.706
  Oxygen (ml/l): 4.502 - 4.502
  Phosphate (umol/l): 0.089 - 0.089
  Silicate (umol/l): 3.088 - 3.088

Graphical representation

Depth range (m): 1 - 5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Littorina scabra is prey of:
Eleotris sandwicensis

Based on studies in:
USA: Hawaii (Swamp)

This list may not be complete but is based on published studies.
  • G. E. Walsh, An ecological study of a Hawaiian mangrove swamp. In: Estuaries, G. H. Lauff, Ed. (AAAS Publication 83, Washington, DC, 1967), pp. 420-431, from p. 429.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

These snails remain above the surface of the sea at all times, and are effectively terrestrial, respiring in air by means of the air-filled mantle cavity with reduced gill folds. If animals are contacted by a rising tide they move upwards to avoid submersion, and then follow the retreating tide downwards, grazing as they go.They are active mainly at night and after rain. Females occasionally move down to the water surface to release their larvae, probably once a month during high spring tides. Like all intertidal littorinids, when animals have been dry for several days they withdraw into the shell and remain attached to the substrate by a film of dry mucus. The foot is not suited to locomotion on sand or mud, and the animals remain on hard substrates at all times.The shell of these arboreal snails is relatively thin and they are therefore susceptible to attack by shell-crushing predators, principally crabs but also molluscivorous fish. Indeed, such is the intensity of crushing predation in mangrove habitats that this may have contributed to the selective pressure to adopt a tree-dwelling habit early in the evolution of the genus.Most shells of L. scabra show evidence of previous attack by crabs, in the form of repaired shell breakages that appear as jagged scars. Such scars indicate that the animal survived attack and then continued shell growth. At a site in north Queensland the average number of such unsuccessful attacks was recorded as 3 per shell. The most numerous molluscivorous crab predators in mangrove habitats in the Indo-Pacific are grapsids of the genus Metapograpsus, which can climb for 5 m into the tree canopy. Other shell-crushing crabs include the portunids Scylla and Thalamita, but these are swimming crabs that do not climb above the water.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Littoraria scabra

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTTGGAATATGATCTGGCCTAGTCGGTACAGCCTTAAGCCTTCTTATTCGAGCTGAATTAGGACAACCAGGCGCTCTGCTAGGAGAT---GATCAACTTTATAATGTTATTGTAACAGCCCATGCGTTCGTTATAATCTTTTTTCTAGTTATACCGATGATAATTGGAGGCTTCGGAAATTGATTAGTCCCTTTAATATTAGGTGCACCCGACATAGCATTTCCTCGGCTAAATAACATAAGATTTTGACTCCTTCCTCCAGCACTTTTACTTCTACTCTCTTCAGCTGCGGTAGAAAGTGGTGTAGGAACTGGATGAACTGTTTACCCACCTCTTGCAGGCAACCTGGCTCACGCCGGGGGCTCTGTAGATCTAGCAATTTTTTCACTCCATCTAGCCGGTGTGTCTTCTATTTTAGGGGCTGTAAATTTCATTACAACCATCATTAATATGCGATGACGAGGTATGCAGTTTGAACGTCTACCTCTCTTTGTTTGATCAGTAAAGATTACAGCTATTCTTCTTCTTTTATCTCTCCCAGTTTTAGCTGGTGCAATTACCATACTCTTAACGGATCGAAACTTCAATACTGCCTTCTTTGACCCTGCCGGAGGAGGAGAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Littoraria scabra

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Conservation

This species is not endangered at present, but is threatened by widespread destruction of mangrove forests.With planktonic larvae, recruitment can probably occur from distant source populations.The animal is edible and gathered for for food in some indigenous communities, but in general the small size, and the gritty texture of females carrying larvae, make this an unpopular shellfish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Littoraria scabra

Littoraria scabra, common name : the mangrove periwinkle, is a species of sea snail, a marine gastropod mollusk in the family Littorinidae, the winkles or periwinkles.[1]

Contents

Description

The size of an adult shell varies between 15 mm and 40 mm.

Distribution

This species is distributed in the Red Sea, the Indian Ocean along Aldabra, Chagos, South Africa, Kenya, Madagascar, the Mascarene Basin, Mauritius, Mozambique, the Seychelles and Tanzania; in the Pacific Ocean along Hawaii and New Zealand.

References

  1. ^ a b Littoraria scabra (Linnaeus, 1758). Reid, David G. (2010). Littoraria scabra (Linnaeus, 1758). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=208939 on 6 June 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!