Molecular Biology and Genetics
Molecular Biology
Statistics of barcoding coverage: Littorina striata
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Barcode data: Tectarius striatus
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
TTTGGTATATGATCTGGCCTTGTAGGAACAGCCCTGAGCTTACTTATTCGAGCTGAACTGGGGCAACCTGGAGCACTTCTCGGAGAC---GATCAATTATACAATGTAATCGTGACAGCACATGCATTTGTCATAATCTTTTTTCTTGTTATGCCTATAATGATTGGCGGATTTGGTAATTGACTTGTTCCTTTAATATTAGGAGCACCAGACATAGCTTTCCCCCGACTCAACAACATAAGTTTCTGACTACTTCCTCCCGCTTTACTTTTGTTACTCTCTTCAGCAGCTGTTGAAAGTGGTGTAGGAACTGGATGGACTGTTTATCCCCCTCTCGCTGGAAATCTTGCCCATGCAGGTGGTTCCGTAGACTTAGCAATTTTCTCTTTACATCTAGCAGGTGTTTCATCCATTCTAGGAGCCGTAAATTTTATTACTACTATTATCAATATACGATGACGGGGTATACAATTTGAACGCTTGCCTCTCTTTGTTTGATCAGTAAAAATTACAGCCATTCTACTACTACTCTCCCTTCCGGTTTTAGCAGGAGCTATTACTATATTACTTACCGACCGTAACTTTAACACTGCCTTTTTTGACCCCGCCGGAGGAGGTGAC
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Tectarius striatus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Wikipedia
Tectarius striatus
Tectarius striatus is a species of sea snail, a marine gastropod mollusk in the family Littorinidae, the winkles or periwinkles.[1]
Contents |
Description
 | This section is empty. You can help by adding to it. (June 2010) |
Distribution
| This section is empty. You can help by adding to it. (June 2010) |
References
- ^ a b Tectarius striatus (King & Broderip, 1832). WoRMS (2010). Tectarius striatus (King & Broderip, 1832). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=449148 on 6 June 2010.
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
