Physical Description

Type Information

Holotype for Littorina patula Gould, 1849
Catalog Number: USNM 5636
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Locality: San Francisco, California, United States, North Pacific Ocean
  • Holotype: Gould, A. A. 1849. Proc. Boston Soc. nat. Hist. 3: 83.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 10.151 - 10.151
  Nitrate (umol/L): 6.725 - 6.725
  Salinity (PPS): 31.893 - 31.893
  Oxygen (ml/l): 6.561 - 6.561
  Phosphate (umol/l): 0.943 - 0.943
  Silicate (umol/l): 15.658 - 15.658
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Littorina keenae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTGGNATATGATCCGGATTAGTTGGTACTGCTTTAAGCCTTCTTATTCGAGCTGAATTAGGCCAACCTGGTGCCCTTTTAGGGGAC---GACCAGTTATATAACGTAATTGTGACAGCTCACGCCTTTGTAATAATTTTTTTTTTAGTTATACCTATGATAATTGGTGGCTTCGGCAACTGACTTGTTCCTTTAATGTTGGGGGCACCAGATATGGCATTCCCTCGACTGAATAATATAAGTTTTTGATTACTCCCTCCTGCTCTATTACTTTTGCTCTCCTCCGCCGCAGTCGAGAGAGGTGTAGGAACAGGCTGAACAGTATATCCTCCTCTAGCGGGAAACTTAGCTCACGCTGGAGGTTCTGTCGACCTAGCAATTTTTTCTCTCCACTTAGCAGGTGTTTCTTCTATTTTAGGAGCCGTAAATTTTATTACAACTATTGTTAATATACGGTGACGAGGTATGCAATTTGAGCGATTACCTCTTTTTGTCTGGTCTGTAAAAATCACAGCTATCCTCTTACTCCTATCCCTCCCAGTCTTAGCCGGAGCCATTACTATGTTATTAACAGACCGAAATTTTAACACCGCTTTCTTTGACCCGGCCGGAGGTGGAGAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Littorina keenae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 6 specimens with morphological vouchers housed at Ocean Genome Legacy
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Littorina keenae

Littorina keenae is a species of sea snail, a marine gastropod mollusk in the family Littorinidae, the winkles or periwinkles.[1]

Contents

Description

Distribution

References

  1. ^ a b Littorina keenae Rosewater, 1978. Reid, David G. (2009). Littorina keenae Rosewater, 1978. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=445651 on 6 June 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!