Physical Description
Type Information
Holotype for Littorina patula Gould, 1849
Catalog Number: USNM 5636
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Locality: San Francisco, California, United States, North Pacific Ocean
Catalog Number: USNM 5636
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Locality: San Francisco, California, United States, North Pacific Ocean
- Holotype: Gould, A. A. 1849. Proc. Boston Soc. nat. Hist. 3: 83.
© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Trusted
Ecology
Habitat
Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.
Environmental ranges
Depth range (m): 0 - 0
Temperature range (°C): 10.151 - 10.151
Nitrate (umol/L): 6.725 - 6.725
Salinity (PPS): 31.893 - 31.893
Oxygen (ml/l): 6.561 - 6.561
Phosphate (umol/l): 0.943 - 0.943
Silicate (umol/l): 15.658 - 15.658
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 1 sample.
Environmental ranges
Depth range (m): 0 - 0
Temperature range (°C): 10.151 - 10.151
Nitrate (umol/L): 6.725 - 6.725
Salinity (PPS): 31.893 - 31.893
Oxygen (ml/l): 6.561 - 6.561
Phosphate (umol/l): 0.943 - 0.943
Silicate (umol/l): 15.658 - 15.658
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Littorina keenae
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
TTTGGNATATGATCCGGATTAGTTGGTACTGCTTTAAGCCTTCTTATTCGAGCTGAATTAGGCCAACCTGGTGCCCTTTTAGGGGAC---GACCAGTTATATAACGTAATTGTGACAGCTCACGCCTTTGTAATAATTTTTTTTTTAGTTATACCTATGATAATTGGTGGCTTCGGCAACTGACTTGTTCCTTTAATGTTGGGGGCACCAGATATGGCATTCCCTCGACTGAATAATATAAGTTTTTGATTACTCCCTCCTGCTCTATTACTTTTGCTCTCCTCCGCCGCAGTCGAGAGAGGTGTAGGAACAGGCTGAACAGTATATCCTCCTCTAGCGGGAAACTTAGCTCACGCTGGAGGTTCTGTCGACCTAGCAATTTTTTCTCTCCACTTAGCAGGTGTTTCTTCTATTTTAGGAGCCGTAAATTTTATTACAACTATTGTTAATATACGGTGACGAGGTATGCAATTTGAGCGATTACCTCTTTTTGTCTGGTCTGTAAAAATCACAGCTATCCTCTTACTCCTATCCCTCCCAGTCTTAGCCGGAGCCATTACTATGTTATTAACAGACCGAAATTTTAACACCGCTTTCTTTGACCCGGCCGGAGGTGGAGAC
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Littorina keenae
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Genomic DNA is available from 6 specimens with morphological vouchers housed at Ocean Genome Legacy
© Ocean Genome Legacy
Source:
Ocean Genome Resource
Trusted
Wikipedia
Littorina keenae
Littorina keenae is a species of sea snail, a marine gastropod mollusk in the family Littorinidae, the winkles or periwinkles.[1]
Contents |
Description
 | This section is empty. You can help by adding to it. (June 2010) |
Distribution
| This section is empty. You can help by adding to it. (June 2010) |
References
- ^ a b Littorina keenae Rosewater, 1978. Reid, David G. (2009). Littorina keenae Rosewater, 1978. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=445651 on 6 June 2010.
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
