You are viewing this Species as classified by:

Overview

Comprehensive Description

Description

 A very small winkle (growing up to 0.9 cm in height) with a high pointed spire and flat sides. The shell resembles a grape pip. The aperture is oval shaped with a pointed apex and the outer lip bears a transparent flap-like extension (the periostracum). The shell is dark bluish to blackish-brown in colour, occasionally with spiral banding or vertical stripes on the last whorl. Pale shells may also occur.It feeds primarily on black lichens and detritus. Breeding occurs from autumn to spring.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 53 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): 0 - 1.5
  Temperature range (°C): 11.471 - 12.348
  Nitrate (umol/L): 4.729 - 6.151
  Salinity (PPS): 35.184 - 35.363
  Oxygen (ml/l): 6.128 - 6.200
  Phosphate (umol/l): 0.336 - 0.421
  Silicate (umol/l): 2.315 - 3.285

Graphical representation

Depth range (m): 0 - 1.5

Temperature range (°C): 11.471 - 12.348

Nitrate (umol/L): 4.729 - 6.151

Salinity (PPS): 35.184 - 35.363

Oxygen (ml/l): 6.128 - 6.200

Phosphate (umol/l): 0.336 - 0.421

Silicate (umol/l): 2.315 - 3.285
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Melarhaphe neritoides lives high on the rocky shore in cracks and crevices, in Lichina pygmaea tufts and in empty barnacle tests. Its upper limit on the shore is determined by the level of wave exposure of the shore, and it often occurs several metres above high water on the most exposed shores.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Melarhaphe neritoides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATATATTTTGTTTGGTATGTGATCTGGTTTAGTAGGAACTGCTCTGAGATTATTAATTCGTGCAGAATTAGGTCAACCCGGAGCACTTTTAGGAGAC---GACCAGTTGTATAATGTAATTGTTACTGCTCATGCATTTGTAATAATTTTCTTTTTAGTTATACCTATAATGATTGGGGGATTTGGTAACTGACTAGTTCCCTTAATACTTGGGGCACCCGATATGGCGTTTCCTCGGCTTAACAATATAAGTTTCTGGTTACTACCACCTGCTCTACTGCTATTACTATCTTCTGCAGCTGTAGAGAGAGGTGTGGGAACTGGGTGGACTGTATACCCACCACTATCCGGCAATTTGGCTCATGCTGGAGGATCTGTAGATCTTGCTATTTTTTCTTTGCATTTAGCAGGAGTTTCATCTATTTTAGGTGCTGTAAATTTTATTACAACAATTATTAATATACGATGACGTGGAATACAGCTAGAACGACTACCTTTATTTGTTTGATCTGTAAAAATTACTGCAATTTTACTTTTACTTTCTTTACCTGTCCTAGCTGGAGCTATTACTATGCTTTTAACTGATCGAAATTTCAACACAGCATTTTTCGACCCCGCAGGAGGTGGAGATCCTATTTTATACCAGCACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Melarhaphe neritoides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Melarhaphe neritoides

Melarhaphe neritoides, common name : the small periwinkle, is a species of small sea snail, a marine gastropod mollusc in the family Littorinidae, the winkles or periwinkles. [1]

This species was previously known as Littorina neritoides.

Melarhaphe is a monotypic genus, in other words, this is the only species in that genus.

Contents

Description

This is a tiny species with the size of an adult shell varying between 4 mm and 9 mm. It has a high pointed spire. The dark aperture is oval. The purple-brown spiral band can be clearly seen on the body whorl.

The small periwinkle breeds in late winter. Its pelagic egg capsules release planktonic larvae.

Distribution

This species is found in European waters from Norway down south, in the Atlantic Ocean along the Azores, Canary Islands, Cape Verde, Morocco, Mauritania; in the Mediterranean Sea and the Black Sea.

References

  1. ^ a b Reid, David G.; Gofas, S. (2011). Melarhaphe neritoides (Linnaeus, 1758). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=140266 on 2011-05-16

Further reading

  • Backeljau, T. (1986). Lijst van de recente mariene mollusken van België [List of the recent marine molluscs of Belgium]. Koninklijk Belgisch Instituut voor Natuurwetenschappen: Brussels, Belgium. 106 pp
  • Reid, D.G. (1989a) The comparative morphology, phylogeny and evolution of the gastropod family Littorinidae. Philosophical Transactions of the Royal Society of London, Series B 324: 1-110.
  • Britton J. C. (1995) "The relationship between position on shore and shell ornamentation in 2 size-dependent morphotypes of Littorina striata, with an estimate of evaporative water-loss in these morphotypes and in Melarhaphe neritoides". Hydrobiologia 309: 129-142. abstract.
  • Howson, C.M.; Picton, B.E. (Ed.) (1997). The species directory of the marine fauna and flora of the British Isles and surrounding seas. Ulster Museum Publication, 276. The Ulster Museum: Belfast, UK. ISBN 0-948150-06-8. vi, 508
  • de Kluijver, M.J.; Ingalsuo, S.S.; de Bruyne, R.H. (2000). Macrobenthos of the North Sea [CD-ROM]: 1. Keys to Mollusca and Brachiopoda. World Biodiversity Database CD-ROM Series. Expert Center for Taxonomic Identification (ETI): Amsterdam, The Netherlands. ISBN 3-540-14706-3. 1 cd-rom pp
  • Cabral-Oliveira J., Maranhão P. & Pardal M. Â. (June 2009) "The effect of sewage discharge on Melarhaphe neritoides (Gastropoda: Littorinidae) population dynamics". Scientia Marina 73(2): 259-267. doi:10.3989/scimar.2009.73n2259


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!