Ecology

Habitat

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 233.5
  Temperature range (°C): 18.961 - 18.961
  Nitrate (umol/L): 9.112 - 9.112
  Salinity (PPS): 36.557 - 36.557
  Oxygen (ml/l): 3.657 - 3.657
  Phosphate (umol/l): 0.480 - 0.480
  Silicate (umol/l): 5.488 - 5.488

Graphical representation

Depth range (m): 0 - 233.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Echinolittorina angustior

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTATTTGGTATGTGATCTGGCTTAGTGGGTACTGCTTTAAGACTTCTTATTCGAGCTGAATTAGGGCAGCCTGGTGCTCTTTTAGGAGAT---GATCAGTTGTATAACGTTATTGTAACGGCTCATGCCTTTGTAATAATTTTTTTCTTAGTTATACCTATGATAATTGGTGGATTTGGTAATTGGCTTGTTCCCTTAATACTAGGGGCACCTGATATAGCATTTCCTCGTCTAAATAATATAAGTTTCTGGTTACTTCCTCCGGCTTTGTTGTTGTTACTCTCTTCAGCTGCGGTTGAAAGTGGTGTAGGGACTGGGTGGACTGTATATCCTCCGTTGGCGGGTAACTTGGCTCATGCCGGAGGGTCTGTGGACCTAGCGATTTTTTCTCTTCATTTAGCTGGTGTTTCTTCCATTTTGGGAGCTGTAAATTTCATTACAACTATTATTAATATGCGATGACGGGGGATGCAATTTGAACGCTTGCCTCTCTTTGTTTGGTCAGTTAAGATTACGGCTATTTTGCTTCTTTTATCTCTTCCTGTTTTAGCGGGAGCTATTACAATGTTGCTCACTGATCGAAATTTTAATACTGCCTTTTTCGATCCTGCTGGTGGGGGAGACCCAATTTTGTACCAACATTTGTTTTGATTTTTTGGTCACCCAGAAGTTTATATTTTAATTCTTCCTGGTTTTGGGATGATTTCCCATATTGTTAGTCATTACTCTGCTAAGAAAGAAACCTTTGGAACTTTAGGAATGATTTATGCTATGTTGGCTATTGGTGTTCTAGGATTTATTGTCTGAGCTCATCACATGTTTACAGTTGGGATGGATGTAGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Echinolittorina angustior

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Echinolittorina angustior

Echinolittorina angustior is a species of sea snail, a marine gastropod mollusk in the family Littorinidae, the winkles or periwinkles.[1]

Contents

Distribution

Description

The maximum recorded shell length is 17 mm.[2]

Habitat

Minimum recorded depth is 0 m.[2] Maximum recorded depth is 0 m.[2]

References

  1. ^ a b Echinolittorina angustior (Mörch, 1876). Reid, David G. (2010). Echinolittorina angustior (Mörch, 1876). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=419558 on 6 June 2010.
  2. ^ a b c Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!