Molecular Biology and Genetics

Molecular Biology

Barcode data: Echinolittorina aspera

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTATTTGGTATGTGATCTGGCTTAGTAGGTACTGCCTTGAGACTTCTTATTCGAGCTGAATTAGGACAGCCTGGGGCTCTTTTAGGAGAT---GATCAGCTGTACAATGTTATTGTAACAGCTCATGCTTTTGTAATAATTTTTTTCTTAGTTATACCTATGATGATTGGTGGTTTTGGTAATTGGCTTGTTCCTTTAATGCTAGGAGCGCCTGATATGGCATTTCCTCGCTTAAATAATATAAGTTTTTGATTACTTCCTCCGGCTTTATTATTATTGCTTTCTTCAGCCGCAGTTGAAAGTGGTGTAGGAACTGGATGGACTGTATATCCTCCGTTGGCAGGGAATTTAGCTCATGCTGGAGGGTCAGTGGACTTAGCAATTTTTTCTCTTCATTTAGCTGGTGTTTCATCTATTTTAGGGGCTGTAAATTTTATTACGACTATTATTAATATACGATGACGAGGAATGCAGTTTGAGCGTTTACCTCTTTTTGTTTGATCAGTTAAAATTACAGCTATTTTGTTACTTTTATCTCTTCCTGTTTTAGCAGGGGCAATTACAATGCTACTTACTGATCGAAATTTTAACACTGCTTTCTTTGACCCTGCTGGTGGGGGAGATCCAATTTTATATCAACATTTGTTTTGATTCTTTGGGCATCCAGAGGTTTATATTTTAATTCTTCCTGGATTCGGGATGATTTCTCATATTGTTAGTCATTATTCTGCTAAGAAAGAAACTTTTGGGACTTTAGGAATGATTTATGCTATATTAGCCATTGGCGTTTTAGGATTTATCGTTTGGGCTCATCATATGTTTACAGTAGGGATGGACGTAGATACCCGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Echinolittorina aspera

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Echinolittorina aspera

Echinolittorina aspera is a species of sea snail, a marine gastropod mollusk in the family Littorinidae, the winkles or periwinkles.[1]

Contents

Description

Distribution

References

  1. ^ a b Echinolittorina aspera (Philippi, 1846). Reid, David G. (2010). Echinolittorina aspera (Philippi, 1846). In: Bouchet, P.; Gofas, S.; Rosenberg, G. (2010) World Marine Mollusca database. Accessed through: World Register of Marine Species at http://www.marinespecies.eu/aphia.php?p=taxdetails&id=446852 on 6 June 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!