Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

There are various subspecies of rough periwinkles which are difficult to distinguish from one another. The 'authentic' rough periwinkle is very common along the North Sea coast. Their shells have obvious grooves and ribs. Sometimes, the grooves are darker than the rest, appearing as stripes. The shape and color are not always the same: some are truncated while others are peaked, gray or colorful.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 Littorina saxatilis has a plump shell, up to 18 mm in height and 14mm wide with a low spire of 4-5 whorls. The sculpture of the whorls are often V-shaped in section, with deep sutures. The aperture is large and rounded, with the outer lip everted slightly where it meets the columella. The colour of the shell is variable - yellowish white, greenish, reddish, brown - but usually has some pattern and a dark throat.Littorina saxatilis is a highly polymorphic species and there is disagreement about whether morphologically and genetically varied populations should be considered as sub-species or ecotypes. For a full review of littorinids in general, and a comprehensive discussion of past and current views on separating Littorina saxatilis into sub-species see Reid (1996). Reid (1996) also lists all previous synonyms for Littorina saxatilis. Littorina compressa and Littorina arcana are very similar in appearance to Littorina saxatilis. All three species occur together on rocky shores between the Barents Sea and southern Brittany, including the British Isles. See Reid (1996) for distinguishing features.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Arctic Ocean, Baltic sea, Belgian Exclusive Economic Zone, Brandy Cove, Canadian part of the Arctic Ocean, Cobscook Bay, Dorset, Dutch Exclusive Economic Zone, European waters (ERMS scope), German Bight, Goote Bank, Greens Point, Gulf of Maine, Gulf of St. Lawrence, Irish Exclusive economic Zone, Langebaan Lagoon, Mediterranean Sea, Navy Island, North West Atlantic, Oostende, Saguenay Fjord, Saldanha Bay, Sam Orr Pond, St. Lawrence Estuary, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wadden Sea, Wimereux, Zeeland
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Arctic seas to Cape May, New Jersey; Arctic seas to Puget sound
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Syntype for Littorina rudis globosa Jeffreys, 1865
Catalog Number: USNM 337203
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Locality: Dublin Bay, Ireland, United Kingdom, North Atlantic Ocean
  • Syntype: Jeffreys, J. G. British Conchology. 3: 365.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from the nearshore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

supralittoral, intertidal, bathyal, infralittoral and circalittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 400 specimens in 2 taxa.
Water temperature and chemistry ranges based on 66 samples.

Environmental ranges
  Depth range (m): -3 - 20
  Temperature range (°C): 2.411 - 12.348
  Nitrate (umol/L): 0.682 - 7.121
  Salinity (PPS): 25.730 - 35.363
  Oxygen (ml/l): 6.069 - 7.326
  Phosphate (umol/l): 0.048 - 0.547
  Silicate (umol/l): 2.315 - 10.727

Graphical representation

Depth range (m): -3 - 20

Temperature range (°C): 2.411 - 12.348

Nitrate (umol/L): 0.682 - 7.121

Salinity (PPS): 25.730 - 35.363

Oxygen (ml/l): 6.069 - 7.326

Phosphate (umol/l): 0.048 - 0.547

Silicate (umol/l): 2.315 - 10.727
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Littorina saxatilis occurs from the upper eulittoral zone down to the littoral fringe of the intertidal and is typically found in crevices of bedrock, empty barnacle shells and under stones. Littorina saxatilis occurs on salt marshes on the base of Spartina species and on firm mud banks. It also occurs submerged in sheltered, brackish lagoons generally attached to Zostera, Fucus, Ruppia and Potamogeton species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Littorina saxatilis (Littorina saxatilis periwinkle) is prey of:
Fundulus
Myoxocephalus
Tautogolabrus
Butorides
Tringa totanus
Corvus corone
Ammodytes tobianus
Crangon crangon
Podocotyle staffordi

Based on studies in:
USA: Massachusetts, Cape Ann (Littoral, Rocky shore)
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • R. W. Dexter, The marine communities of a tidal inlet at Cape Ann, Massachusetts: a study in bio-ecology, Ecol. Monogr. 17:263-294, from p. 278 (1947).
  • R. W. Dexter, The marine communities of a tidal inlet at Cape Ann, Massachusetts: a study in bio-ecology, Ecol. Monogr. 17:263-294, from p. 287 (1947).
  • R. W. Dexter, The marine communities of a tidal inlet at Cape Ann, Massachusetts: a study in bio-ecology, Ecol. Monogr. 17:263-294, from p. 288 (1947).
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Littorina saxatilis (Littorina saxatilis periwinkle) preys on:
algae
Ulva
Ascophyllum
Fucus
Enteromorpha

Based on studies in:
USA: Massachusetts, Cape Ann (Littoral, Rocky shore)
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • R. W. Dexter, The marine communities of a tidal inlet at Cape Ann, Massachusetts: a study in bio-ecology, Ecol. Monogr. 17:263-294, from p. 278 (1947).
  • R. W. Dexter, The marine communities of a tidal inlet at Cape Ann, Massachusetts: a study in bio-ecology, Ecol. Monogr. 17:263-294, from p. 287 (1947).
  • R. W. Dexter, The marine communities of a tidal inlet at Cape Ann, Massachusetts: a study in bio-ecology, Ecol. Monogr. 17:263-294, from p. 288 (1947).
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Littorina saxatilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATATATTTTATTTGGTATATGATCTGGGCTTGTTGGTACTGCCTTAAGCCTTCTTATTCGAGCTGAACTGGGCCAGCCTGGTGCTCTCTTAGGAGAC---GACCAGCTGTACAACGTTATTGTTACAGCTCATGCTTTTGTAATAATTTTTTTCCTAGTTATACCTATAATAATTGGTGGATTCGGAAATTGACTTGTCCCTTTAATATTAGGAGCACCCGATATAGCATTCCCACGTTTAAATAATATAAGCTTTTGACTCCTACCCCCTGCTTTGCTACTGTTATTATCTTCAGCCGCGGTAGAAAGTGGCGTAGGAACAGGCTGAACTGTATACCCCCCTTTGTCCGGAAATTTAGCTCATGCTGGGGGCTCTGTAGATCTGGCTATTTTTTCTCTCCATTTAGCTGGTGTTTCATCTATTTTAGGAGCTGTAAACTTTATTACAACTATTATTAATATACGATGACGAGGTATACAATTTGAACGATTGCCTCTTTTTGTTTGATCAGTAAAAATTACAGCCATTCTTCTACTTCTATCCCTTCCTGTTTTAGCAGGGGCTATTACAATATTACTAACCGATCGAAATTTTAATACTGCTTTCTTCGATCCAGCTGGGGGAGGAGACCCTATTCTCTATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Littorina saxatilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 66
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Australia Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Littorina saxatilis

Littorina saxatilis, common name the rough periwinkle, is a species of small sea snail, a marine gastropod mollusc in the family Littorinidae, the winkles or periwinkles.

Contents

Distribution

This species is native to the shores of the North Atlantic Ocean, including Hudson Bay, Baffin Island, Greenland, and the Barents Sea, south along the American East Coast to Chesapeake Bay, and along the European coast to the Straits of Gibraltar.

This species has also been introduced to San Francisco Bay, on the West Coast of the United States, where it was first observed in 1992.

Shell description

The shell in life often appears green with algae, but the shell itself can be white, red, or brown, sometimes with checkered lines. The shell has 4-5 whorls. Maximum recorded shell length is 19 mm.[2][3]

Ecology

Habitat

This species frequently lives in salt marshes. it can also be found in crevices of intertidal bedrock, in empty barnacle shells, and under rocks. Like many other periwinkles, this species can survive long exposures out of the water.[citation needed]

The species has been recorded alive from depth range 0 - 46 m[2] or up to 183 m (for shells only).[3]

In the exposed Galician coast in the Northern Spain, two well differentiated ecotypes are adapted to different shore levels and habitats.[4] The RB ecotype (Ridged and Banded) lives on barnacles in the upper shore.[4] This ecotype displays a larger and more robust shell to resist the attack from predators such as crabs, and a smaller shell aperture in order to reduce the desiccation due to high sunshine exposure.[4] The SU ecotype (Smooth and Unbanded) is found at the lower shore living on mussels.[4] This ecotype shows a smaller and thinner shell with a wider shell aperture to allocate a relatively larger muscular foot providing a higher ability to avoid the dislodgment caused by the heavy wave action.[4] Both ecotypes coexist in an intermediate habitat at the middle shore.[4]

Feeding habits

This snail is a herbivore which grazes on the surface of rocks and mud flats.

Life cycle

The marine snail Littorina saxatilis has separate sexes, internal fertilization, and a brood pouch with non-planktonic shelled embryos.[4]

Synonyms

See also

References

This article incorporates CC-BY-2.0 text from the reference [4]

  1. ^ Olivi G. (1792). Zoologia Adriatica, ossia catalogo ragionato degli animali del golfo e della lagune di Venezia. Bassano, Venecia [ix] + 334 + xxxii pp., 9 pls.
  2. ^ a b Littorina saxatilis (Olivi) Malacolog 4.1.1. A Database of Western Atlantic Marine Mollusca.
  3. ^ a b Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
  4. ^ a b c d e f g h Martínez-Fernández M., Bernatchez L., Rolán-Alvarez E. & Quesada H. (2010). "Insights into the role of differential gene expression on the ecological adaptation of the snail Littorina saxatilis". BMC Evolutionary Biology 10: 356. doi:10.1186/1471-2148-10-356.

Further reading

  • Carvajal-Rodríguez A., Conde-Padín P. & Rolán-Alvarez E (2005). "Decomposing shell form into size and shape by geometric morphometric methods in two sympatric ecotypes of Littorina saxatilis. Journal of Molluscan Studies 71: 313-318.
  • Galindo J., Morán P. & Rolán-Alvarez E. (2009). "Comparing geographical genetic differentiation between candidate and noncandidate loci for adaptation strengthens support for parallel ecological divergence in the marine snail Littorina saxatilis". Molecular Ecology 18: 919-930.
  • Hayward, P.J.; Ryland, J.S. (Ed.) (1990). The marine fauna of the British Isles and North-West Europe: 1. Introduction and protozoans to arthropods. Clarendon Press: Oxford, UK. ISBN 0-19-857356-1. 627 pp.
  • Johannesson B. (1986). "Shell morphology of Littorina saxatilis Olivi the relative importance of physical factors and predation". J Exp Mar Bio Ecol 102: 183-195.
  • Johannesson K., Johannesson B. & Rolán-Alvarez E. (1993). "Morphological differentiation and genetic cohesiveness over a micro-environmental gradient in the marine snail Littorina saxatilis". Evolution 47: 1770-1787.
  • Reid, D.G. (1989a) The comparative morphology, phylogeny and evolution of the gastropod family Littorinidae. Philosophical Transactions of the Royal Society of London, Series B 324: 1-110
  • Reid D.G. (1996). Systematics and evolution of Littorina. The Ray Society 463p.
  • Rolán-Alvarez E. (2007). "Sympatric speciation as a by-product of ecological adaptation in the Galicia Littorina saxatilis hybrid zone". Journal of Molluscan Studies 73: 1-10.
  • Rolán-Alvarez E., Johannesson K. & Erlandsson J. (1997). "The maintenance of a cline in the marine snail Littorina saxatilis: the role of home site advantage and hybrid fitness in ecotype formation". Evolution 51: 1838-1847.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!