Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Flat periwinkles are smaller than common periwinkles, but stand out due to their bright colors. The shell can vary between yellow, orange, brown or green, and even blue-gray fossils are found. Of all periwinkle species, this species is the least resistant to dehydration during low tide. Therefore, it lives deeper than other periwinkles in order to avoid lying exposed during low tide. Should that happen, it crawls at its fastest snail rate under a seaweed or stone.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Breeding may take place throughout the year, but tends to reach a peak in spring and early summer (2). The sexes are separate (individuals are either male or female), and fertilisation occurs internally after copulation (2). The white egg masses are typically kidney-shaped or oval (3), and contain up to 280 eggs (2). They are usually laid on the fronds of the brown seaweeds on which the species feeds but may also occur on the rock surface (2). The crawling young hatch four weeks after the eggs are laid. The young periwinkles become sexually mature at around 2 years of age, and they typically live for a total of three years (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Periwinkles are a large family of gastropod molluscs found on the shore. The flat periwinkle is so-called because the spire of the shell is flattened (2). The tear-drop shaped aperture is large (3), and the colour is variable depending on the habitat. It is usually olive-green but may be brown, yellow, banded or have a criss-cross pattern (2). Lighter colours are associated with sheltered shores (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

 A small periwinkle (up to 1.5 cm in height), it has a flattened spire and large tear-drop shaped aperture. The last whorl makes up about 90% of the height of the shell and the outer lip joins the body a little below the apex. The shell appears smooth but upon closer inspection is found to be finely reticulate. It is highly variable in colour (from olive green to yellow to banded and chequered patterns) depending on its habitat, with lighter shells being found in more sheltered shores. It may be confused with Littorina fabalis (syn mariae) in which the aperture is larger than the body whorl and the spire is even flatter.Littorina obtusata lays whitish oval or kidney shaped egg masses on Ascophyllum nodosum, Fucus serratus and Fucus vesiculosus, and sometimes on rock surfaces. It takes up to four weeks for crawling young to emerge.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range: 74°N to 39°N; 74°W to 0°W. Distribution: Greenland; Greenland: West Greenland; Canada; Canada: Labrador, Quebec, New Brunswick; USA: Massachusetts, New York, New Jersey
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

This species is common on all British shores where brown seaweeds are found (3). It has a wide distribution in north-west Europe (2) and is found from Northern Norway to the south of Spain and is absent from the Mediterranean (4) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

intertidal, bathyal, infralittoral and circalittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 167 specimens in 1 taxon.
Water temperature and chemistry ranges based on 27 samples.

Environmental ranges
  Depth range (m): -3 - 168
  Temperature range (°C): 4.155 - 12.348
  Nitrate (umol/L): 0.682 - 7.983
  Salinity (PPS): 25.730 - 35.363
  Oxygen (ml/l): 4.958 - 7.250
  Phosphate (umol/l): 0.048 - 0.690
  Silicate (umol/l): 2.315 - 10.627

Graphical representation

Depth range (m): -3 - 168

Temperature range (°C): 4.155 - 12.348

Nitrate (umol/L): 0.682 - 7.983

Salinity (PPS): 25.730 - 35.363

Oxygen (ml/l): 4.958 - 7.250

Phosphate (umol/l): 0.048 - 0.690

Silicate (umol/l): 2.315 - 10.627
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 The flat periwinkle is almost always associated with fucoid algae, in particular Ascophyllum nodosum, Fucus serratus and Fucus vesiculosus from mid to lower tidal levels on rocky shores and occasionally into the sub-littoral. It is tolerant of low salinities and a wide range of exposure.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This periwinkle is closely associated with brown seaweeds, especially Ascophyllum nodosum, Fucus vesiculosus and Fucus serratus on which it feeds. It occurs on the mid-shore to lower tidal levels and may occasionally occur in the sublittoral (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Littorina obtusata (Littorina littorea, L. obtusata, L. saxatilis) is prey of:
Fundulus
Myoxocephalus
Tautogolabrus
Butorides
Corvus

Based on studies in:
USA: Massachusetts, Cape Ann (Littoral, Rocky shore)

This list may not be complete but is based on published studies.
  • R. W. Dexter, The marine communities of a tidal inlet at Cape Ann, Massachusetts: a study in bio-ecology, Ecol. Monogr. 17:263-294, from p. 278 (1947).
  • R. W. Dexter, The marine communities of a tidal inlet at Cape Ann, Massachusetts: a study in bio-ecology, Ecol. Monogr. 17:263-294, from p. 287 (1947).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Littorina obtusata (Littorina littorea, L. obtusata, L. saxatilis) preys on:
algae
Ulva
Ascophyllum
Fucus

Based on studies in:
USA: Massachusetts, Cape Ann (Littoral, Rocky shore)

This list may not be complete but is based on published studies.
  • R. W. Dexter, The marine communities of a tidal inlet at Cape Ann, Massachusetts: a study in bio-ecology, Ecol. Monogr. 17:263-294, from p. 278 (1947).
  • R. W. Dexter, The marine communities of a tidal inlet at Cape Ann, Massachusetts: a study in bio-ecology, Ecol. Monogr. 17:263-294, from p. 287 (1947).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Littorina obtusata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 48 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTATTTGGTATATGATCTGGGCTTGTTGGTACTGCCTTAAGCCTTCTTATTCGAGCTGAACTGGGCCAGCCTGGTGCTCTCCTAGGGGAC---GACCAGCTGTACAACGTTATTGTTACAGCTCACGCTTTTGTAATAATTTTTTTCCTAGTTATGCCTATAATAATTGGTGGATTCGGGAATTGACTTGTGCCTTTAATATTAGGAGCACCCGATATAGCATTCCCACGCTTAAATAATATAAGCTTTTGACTCCTCCCACCTGCTTTGCTACTGTTATTATCTTCAGCCGCAGTAGAAAGTGGTGTAGGAACAGGCTGAACTGTATATCCCCCTTTGTCCGGAAATTTGGCTCATGCTGGGGGCTCTGTAGACTTGGCTATTTTCTCTCTCCATTTAGCTGGTGTTTCATCTATTTTAGGAGCTGTAAACTTTATTACAACTATTATTAATATACGATGACGAGGTATACAATTTGAACGATTGCCTCTTTTTGTTTGATCAGTAAAAATTACAGCCATTCTTCTACTTCTATCCCTTCCTGTTTTAGCAGGAGCTATTACAATATTACTAACCGATCGAAATTTTAATACTGCTTTCTTCGATCCTGCTGGAGGAGGAGACCCTATTCTCTACCAACACTTATTTTGATTCTTTGGCCACCCAGAAGTATATATTTTAATTCTCCCTGGGTTTGGTATAATTTCCCATATTGTTAGTCACTACTCTGCTAAGAAAGAAACTTTTGGAACTTTAGGTATAATCTATGCAATACTTGCTATTGGTGTTTTAGGATTTATTGTATGAGCCCACCATATATTTACAGTAGGTATAGATGTAGACACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Littorina obtusata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 48
Specimens with Barcodes: 79
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Australia Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Not threatened (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

This species is not threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

Not relevant.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Littorina obtusata

Littorina obtusata, common name the flat periwinkle, is a species of sea snail, a marine gastropod mollusk in the family Littorinidae, the winkles or periwinkles.[1]

Distribution[edit]

This marine species occurs wherever brown seaweeds grow. It is widely distributed : the Baltic Sea, in European waters from Norway down to Southern Spain, in the Mediterranean Sea, in the Northwest Atlantic Ocean along the Gulf of Maine.

Description[edit]

The maximum recorded shell length is 13.5 mm.[2]

Habitat[edit]

This species can be found in the littoral and sublittoral zone on rocky shores and piers, usually on brown algae of the genus Fucus. Minimum recorded depth is 0 m.[2] Maximum recorded depth is 110 m.[2] The habitat defines its color. On sheltered shores it has a lighter and uniform color (yellow, brown, orange or olive green). On exposed shores its color is darker and chequered.

References[edit]

Notes
  1. ^ a b Littorina obtusata (Linnaeus, 1758). Gofas, S. (2010). Littorina obtusata (Linnaeus, 1758). In: Bouchet, P.; Gofas, S.; Rosenberg, G. (2010) World Marine Mollusca database. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=140263 on 6 June 2010.
  2. ^ a b c Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
Bibliography
  • Backeljau, T. (1986). Lijst van de recente mariene mollusken van België [List of the recent marine molluscs of Belgium]. Koninklijk Belgisch Instituut voor Natuurwetenschappen: Brussels, Belgium. 106 pp
  • Reid, D.G. (1989a) The comparative morphology, phylogeny and evolution of the gastropod family Littorinidae. Philosophical Transactions of the Royal Society of London, Series B 324: 1-110
  • Reid D.G. (1996). Systematics and evolution of Littorina. The Ray Society 463p
  • BODC (2009). Species list from the British Oceanographic Data Centre
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!