Overview

Comprehensive Description

General Description

A fairly large (3.8-5.9 cm. wingspan) orange, yellow-brown or rusty-orange moth, with prominent antemedian and postmedian lines. There are a pair of diagnostic small silvery white spots in the center of the pointed forewing. Male antennae are bipectinate and the females have simple antennae. Unlikely to be mistaken for any other Alberta moth. The similar Notodontid moth Datana ministra should also occur in southern Alberta; it can be separated from Nadata by it's maroon head and thorax.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Transcontinental across the wooded portions of Canada, south to Florida and California. In Alberta, found mainly in the Boreal Forest region, north to the north shore of Lake Athabasca and the Peace River; less commonly in the Aspen Parklands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Deciduous and mixedwood forest and shrubland.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

No Alberta data available. Elsewhere in Canada, a wide variety of deciduous trees and shrubs, with a very strong preference for white birch (Betula papyrifera), and to a lesser extent Red alder (Alnus rubra) and willow (Salix) (Prentice et al, 1962).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Adults are on the wing from the end of May to late July. Larvae from late June through early Sept.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Adults are nocturnal and come to lights. There is a single brood, which overwinter as pupae. The larvae are solitary defoliators.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nadata gibbosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 50 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNAACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCATTAAGATTATTAATTCGTGCTGAATTAGGAAACCCTGGGTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACTGCCCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCCCTAATACTAGGAGCCCCTGACATAGCTTTCCCCCGTATAAATAATATAAGTTTCTGACTCTTACCCCCATCTCTAACTTTACTTATTTCAAGTAGTATCGTAGAAAATGGAGCAGGAACAGGTTGAACAGTTTATCCCCCCCTATCTTCGAATATTGCCCATGGAGGTAGTTCTGTTGATTTAGCAATCTTTTCTTTACATTTAGCAGGAATTTCTTCTATTCTAGGAGCCATTAATTTTATTACTACAATTATTAATATACGTCTTAATGGAATATCTTTTGATCAAATACCTTTATTCGTATGAGCTGTAGGAATTACTGCATTTTTACTTCTTTTATCCTTGCCTGTATTAGCTGGAGCCATTACAATATTATTAACTGATCGAAACTTAAATACTTCTTTCTTTGATCCTGCTGGAGGAGGAGATCCTATTCTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Nadata gibbosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 40
Specimens with Barcodes: 199
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

A fairly common, widespread species.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Rough Prominent

The Rough Prominent (Nadata gibbosa) is a moth of the family Notodontidae, possibly in the subfamily Notodontidae. It is also known as the White-dotted Prominent and the Tawny Prominent. This common moth is found across North America from the northern boreal forests to as far south as Florida. It is most common in deciduous forests at some elevation. It is nocturnal but attracted to lights. The moths start to fly soon after dusk and return to resting places some time before dawn breaks (Fullard & Napoleone 2001). The adults live through late spring and early summer, and larvae are active until fall. They then pupate until the following spring.

The moth is tan or dull orange in color, with two small silver spots on each forewing. The wingspan is approximately 2 inches. It sports a pointed thoracic tuft between its wings.

Life Cycle[edit]

Larva[edit]

The larva is blue-green, turning bright green as it approaches pupation age. It has a large head capsule, yellow mandibles, and yellow longitudinal stripes down its body. It feeds on the leaves of oaks and other deciduous trees (see list below). The larva is sometimes called the green oak caterpillar.

Recorded food plants[edit]

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!