Overview

Comprehensive Description

Biology

Meso- and bathypelagic (Ref. 58302). Males dwarfed and non-parasitic (Ref. 4491). Caught with plankton nets (Ref. 559). Capable of catching and swallowing prey larger than itself, as witness the approximately 24.0 cm SL specimen of Chauliodus sp. in the stomach of a 6.6 cm SL individual (NMNZ P 14537) (Ref. 58502). Larvae are found primarily in upper 100 m (Ref. 36493). Oviparous, with planktonic larvae (Ref. 36493). Eggs are presumably contained in floating gelatinous rafts (Ref. 36493).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Data on Catalog of Fishes

View data on Catalog of Fishes here.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type locality

Off Madeira, 24 December 1863.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type specimen(s)

Holotype of Melanocetus johnsonii: BMNH 1864.7.18.6, female, 64 mm.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Main Reference

Pietsch TW. 2009. Oceanic Anglerfishes: Extraordinary Diversity in the Deep Sea. Berkley: University of California Press. 638 p.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Escal bulb slightly compressed, with a low rounded or conical distal prolongation nearly always darkly pigmented on tip; a compressed posterior crest usually darkly pigmented, becoming larger and more conspicuous with growth; a considerably smaller compressed anterior crest present in some specimens; integument relatively thick (cross sections measuring 1.55 mm in thickness), not easily torn, usually retaining heavy pigmentation during fixation and preservation; vomerine teeth 2–12; dorsal-fin rays 13–15 (rarely 16); anal-fin rays 4 (very rarely 3 or 5); pectoral-fin rays 17–22 (rarely 23).

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Tropical to temperate parts of all oceans. South China Sea and East China Sea (Ref.74511).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

tropical to temperate parts of all oceans, as far north as Sable Island Bank
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

European waters (ERMS scope), Gulf of Maine, Gulf of Mexico, New Zealand Exclusive Economic Zone, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Melanocetus johnsonii has a wide horizontal distribution in tropical and subtropical waters of all three major oceans of the world between approximately 55°N and 45°S. Compared to its congener M. murrayi, it appears to occupy relatively shallow depths: about 62% of the material (for which data are available) was captured by open nets fished at maximum depths of 1000 m; 82% of the material can be accounted for by gear fished above 1500 m, and 98% by gear fished above 2100 m.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical through cold temperate seas, including Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 1; Dorsal soft rays (total): 13 - 17; Analspines: 0; Analsoft rays: 3 - 5
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The body of metamorphosed females is short and deep, globular, the depth 60–75% SL (but often appearing highly compressed due apparently to deformation following capture). The head is short, the mouth large, its opening oblique to nearly vertical and the cleft not extending past the eye. The jaws are equal anteriorly. The oral valves are only weakly developed. There are two nostrils on each side of the snout, situated on the distal surface of a rounded papilla. The eye is small and subcutaneous, appearing through a circular translucent area of the integument, within a shallow orbital pit formed between the sphenotic and frontal bones. The teeth are slender, recurved, and depressible, some slightly hooked distally, those in the lower jaw less numerous (except in some small specimens, less than approximately 20 mm) but slightly longer than those in the upper jaw. There are 29–178 teeth in upper jaw and 32–142 in lower jaw. The longest tooth in the lower jaw measures 6.9–25.0% SL. There are 0–12 vomerine teeth. The first epibranchial and the proximal one-half of the first ceratobranchial are bound to the wall of the pharynx by connective tissue. All four epibranchials are closely bound together. The fourth epibranchial and ceratobranchial are bound to the wall of the pharynx, leaving no opening behind the fourth arch. The proximal one-half of the first ceratobranchial is bound to the wall of the pharynx, while the distal half is free, not bound by connective tissue to the adjacent second ceratobranchial. The proximal one-quarter to one-half of ceratobranchials II–IV are not bound together by connective tissue. Gill filaments are absent on the epibranchials, but present on the proximal tip of ceratobranchial I and the full length of ceratobranchials II–IV. A pseudobranch is absent. The length of illicium is 23.1–60.8% SL. The anterior-most tip of the pterygiophore of the illicium is exposed, emerging on the snout between the eyes, the posterior end concealed under the skin. The escal bulb is simple, usually with a rounded or conical distal prolongation, and often with posterior and anterior crests. Elongate cylindrical escal appendages and filaments are absent. The neuromasts of the acoustico-lateralis system are located at the tips of low cutaneous papillae, the pattern of placement as described for other ceratioids.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 28 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

2.9 cm TL (male/unsexed; (Ref. 4491)); 18 cm TL (female)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from 852 metamorphosed females (10–154 mm), eight metamorphosed males (15.5–28 mm), and 329 larvae (2.5–17.5 mm TL).

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Esca with compressed posterior and anterior crests; anterior margin of vomer nearly straight; minute skin spines present over most of body (Ref. 13608). Branchiostegal rays 6 (Ref. 36493). Caudal-fin rays 8. Scales are cone-shaped, hollow and translucent; with circular base and a free edge pointing towards the caudal region. Left otolith, oblong shape with regular edges, inner face does not present rostrum, antirostrum or cisure (Ref. 41244).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Metamorphosed females of Melanocetus johnsonii are distinguished from those of all other described species of the genus in having the anterior margin of the vomer nearly straight; least outside width between frontals 13.5–28.6% SL; number of teeth in upper jaw 48–134, in lower jaw 32–78; length of longest tooth in lower jaw 8.4–25.0% SL; width of pectoral-fin lobe 10.7–17.8% SL; width of escal bulb 4.3–8.6% SL; length of illicium 32.4–60.8% SL; esca with posterior and usually anterior crests; skin with minute spinules over most of body; integument relatively thick (1.55 mm).

Metamorphosed males of Melanocetus johnsonii differ from those of all other described species of the genus in having upper denticular with 9–13 ventrally directed anterior teeth and a postero-medial series of 8–11 teeth; lower denticular with 12–24 teeth; posterior nostril contiguous with eye; as many as 24 olfactory lamellae; skin naked or spinulose.

Larvae of Melanocetus johnsonii are distinguished from those of all other described species of the genus in having anterior body musculature unpigmented; dorsal pigment extending posteriorly to beneath middle of base of dorsal fin; a separate lateral group of peduncular pigment in smaller specimens, connecting in larger specimens with dorsal pigmentation; branchial pigmentation strong; branchiostegal, cephalic, sphenotic, preopercular, and pectoral pigment usually present.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

bathypelagic; marine; depth range 100 - 4500 m (Ref. 74511), usually 100 - 1500 m (Ref. 4118)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occasionally found in Canadian Atlantic waters. Found to depths of 2091 m.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 86 specimens in 1 taxon.
Water temperature and chemistry ranges based on 74 samples.

Environmental ranges
  Depth range (m): 0 - 4300
  Temperature range (°C): 1.785 - 22.540
  Nitrate (umol/L): 0.259 - 44.278
  Salinity (PPS): 34.009 - 36.564
  Oxygen (ml/l): 0.217 - 7.011
  Phosphate (umol/l): 0.043 - 3.220
  Silicate (umol/l): 1.049 - 163.066

Graphical representation

Depth range (m): 0 - 4300

Temperature range (°C): 1.785 - 22.540

Nitrate (umol/L): 0.259 - 44.278

Salinity (PPS): 34.009 - 36.564

Oxygen (ml/l): 0.217 - 7.011

Phosphate (umol/l): 0.043 - 3.220

Silicate (umol/l): 1.049 - 163.066
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Meso- to bathypelagic.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 2091m.
Recorded at 2091 meters.

Habitat: bathypelagic. Mesopelagic species (Ref. 4491). Males dwarfed and non-parasitic (Ref. 4491). Caught with plankton nets (Ref. 559).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Capable of catching and swallowing prey larger than itself, as witness the approximately 24.0 cm SL specimen of Chauliodus sp. in the stomach of a 6.6 cm SL individual (NMNZ P 14537) (Ref. 58502). Males dwarfed and non-parasitic (Ref. 4491). Caught with plankton nets (Ref. 559). Larvae are found primarily in upper 100 m (Ref. 36493).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous (Ref. 36493).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Until very recently, the only evidence of sexual parasitism in this family was an anomalous case of a 20-mm male Melanocetus johnsonii attached to the upper lip of a 168-mm female Centrophryne spinulosa (LACM 30843-1). However, the attachment did not involve fusion of male-female tissue and is therefore not considered to be a parasitic association. Two similar couplings in Melanocetus, but between sexes of the same taxon, have recently been discovered. One of these, a 23.5-mm male attached to a 75-mm female Melanocetus johnsonii (BMNH 2004.6.3.2-3), was collected in the eastern North Atlantic off Ireland in 1999 by the RRS Discovery in a cruise partially funded by the British Broadcasting Corporation for the celebrated “Blue Planet” video series. The second example is part of collections made by Hiromitsu Endo, aboard the R/V Tansei-Maru, west of Okinawa, in April 2002: a 15-mm male attached to a 73-mm female Melanocetus murrayi (BSKU 57842). Both males are only loosely attached, with tissue of the female pinched by the tightly closed denticular jaws of the male, the BMNH example hanging from the middle of the belly of the female, the BSKU specimen attached to the right side of the head of the female, just beneath the sphenotic bone. In both cases, it does not appear that any fusion of male and female tissue has taken place. Either the connections of the two were so recent that the tissues did not have time to fuse, or, more likely, these are the first and only known examples of a non-parasitic coupling—male ceratioids caught in the act of temporary attachment.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Melanocetus johnsonii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTATACCTAATTTTTGGTGCCTGAGCTGGGATAGTAGGCACAGCTTTAAGTTTACTTATCCGCGCCGAACTAAGTCAACCAGGCGCCCTTTTAGGGGACGACCAAATCTACAACGTAATTGTTACGGCACATGCCTTTGTAATAATTTTCTTTATGGTCATACCAATTATAATCGGAGGCTTCGGAAACTGACTAATCCCTCTGATGATCGGGGCCCCGGACATAGCATTTCCTCGAATAAACAACATAAGCTTCTGGCTACTTCCTCCATCTTTTCTCCTCCTCCTTGCCTCCTCTGGAGTAGAGTCGGGAGCAGGGACTGGGTGAACAGTTTACCCCCCTCTCTCAGGCAACCTGGCCCATGCTGGAGCTTCTGTTGACCTGACAATTTTCTCCCTTCATCTGGCCGGGGTATCCTCAATTCTAGGGGCCATTAACTTTATCACAACAATTATTAATATGAAACCCCCGGCCATTTCTCAATACCAGACCCCCCTCTTCGTATGGTCCGTCTTGATCACCGCCGTCCTCCTTTTACTCTCTCTGCCTGTCCTTGCTGCTGGTATTACCATACTCCTGACTGACCGGAATCTAAACACAACCTTCTTTGACCCCGCAGGAGGGGGTGACCCAATCCTTTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Melanocetus johnsonii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Humpback anglerfish

The humpback anglerfish or black ballsack, Melanocetus johnsonii, is a deep-sea anglerfish in the family Melanocetidae, found in tropical to temperate parts of all oceans at depths of up to 2,000 meters (6,600 feet). Its length is up to 3 centimeters (1.2 inches) for males and up to 20 centimeters (8 inches) for females.

The male [edit]

Male humpback angler fish are much smaller than the females, being no more than 3 cm (just over an inch) long, whereas the female typically reaches 18 cm (7 inches) in length. Hump back angler fish remain free swimming into adulthood, which is not the case with other deep sea anglerfish: with these, males swim freely when young, but before reaching adulthood the male will fix itself permanently to the rear of the female's body, living thereafter as a parasite of the female. The male's internal organs now atrophy as the fish shares the female's blood and becomes simply a sperm provider as required.

References [edit]

  • Froese, Rainer and Pauly, Daniel, eds. (2006). "Melanocetus johnsonii" in FishBase. May 2006 version.
  • Tony Ayling & Geoffrey Cox, Collins Guide to the Sea Fishes of New Zealand, (William Collins Publishers Ltd, Auckland, New Zealand 1982) ISBN 0-00-216987-8
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!