Ecology

Associations

Known predators

Tinodes waeneri is prey of:
Actinopterygii
Aves
Chiroptera

Based on studies in:
UK: Yorkshire, Aire, Nidd & Wharfe Rivers (River)

This list may not be complete but is based on published studies.
  • E. Percival and H. Whitehead, 1929. A quantitative study of the fauna of some types of stream-bed. J. Ecol. 17:282-314, from p. 311 & overleaf.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Tinodes waeneri preys on:
Bryophyta
algae
Bacillariophyceae

Based on studies in:
UK: Yorkshire, Aire, Nidd & Wharfe Rivers (River)

This list may not be complete but is based on published studies.
  • E. Percival and H. Whitehead, 1929. A quantitative study of the fauna of some types of stream-bed. J. Ecol. 17:282-314, from p. 311 & overleaf.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Tinodes waeneri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Tinodes waeneri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GATATAGCTTTCCCACGAATAAATAACCTTAGATTTTGATTTTTACCCCCYTCTTTATTTTTCTTAATTTCTAGAATATTTATAGATAATAGAATAGGAACAGGATGAACTGTTTACCCACCATTATCTAACAGAATATTTCACTCAGGGAAAGCTGTTGATATTAGAATTTTTTCCCTTCATTTAGCAGGAATTTCATCTATTTTAGGGGCTATTAATTTTATTTCTACTATTATAAATATAAAACTTAATGCTATTTCATTAAATTTAGTACCATTATTTGTTTGATCTGTTAATATTACAGCTTTATTATTATTATTATCTTTACCAGTATTAGCTGGTGCTATTACCATATTATTAACAGACCGAAATTTAAACACCTCCTTCTTTAACCCAGCTGGAGGAGGGGATCCAATTTTATATCAACATTTATTTTGATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!