Ecology

Associations

Known predators

Leuctra (Leuctra (N=5)) is prey of:
Hydropsyche
Rhyacophila
Dinocras
Chloroperla
Polycentropus
Isoperla
Perlodes
Herpodbella octoculata
Salmo salar
Caudata
Ajax longipes
Alloperla
Hexatoma
Ophiogomphus
Notropis heterolepis
Gomphus

Based on studies in:
Wales, River Clydach (River)
Wales, River Rheidol (River)
Wales, Dee River (River)
USA: North Carolina, Coweeta (River)
USA: Maine, Martins (River)
USA: Maine, Troy (River)

This list may not be complete but is based on published studies.
  • J. R. E. Jones, A further ecological study of calcareous streams in the "Black Mountain" district of South Wales, J. Anim. Ecol. 18:142-159, from p. 157 (1949).
  • J. R. E. Jones, A further ecological study of the river Rheidol: the food of the common insects of the main-stream, J. Anim. Ecol. 19:159-174, from p. 172 (1950).
  • R. M. Badcock, 1949. Studies in stream life in tributaries of the Welsh Dee. J. Anim. Ecol. 18:193-208, from pp. 202-206 and Price, P. W., 1984, Insect Ecology, 2nd ed., New York: John Wiley, p. 23
  • Thompson, RM and Townsend CR. 2005. Energy availability, spatial heterogeneity and ecosystem size predict food-web structure in streams. OIKOS 108: 137-148.
  • Thompson, RM and Townsend, CR. 2003. Impacts on stream food webs of native and exotic forest: an intercontinental comparison. Ecology 84:145-161
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Leuctra (Leuctra (N=5)) preys on:
leaf fragments
green algae
Ulothrix
detritus
Bacillariophyceae
stem tissue
fragmented leaf
Bryophyta
Batrachospermum
Lemanea
algae
plant tissue
Plant material
Cyanobacteria
organic matter
Achnanthes minutissima
Cocconeis placentula
Cymbella kappii
Navicula avenacea
Calothrix

Gomphoneis herculeana
Schizothrix
organic detritus
Terrestrial invertebrates
Frustulia rhomboides
Gomphonema herculeana
Pinnularia viridis
Tabellaria flocculosa

Based on studies in:
Wales, River Clydach (River)
Wales, River Rheidol (River)
USA: North Carolina, Coweeta (River)
USA: Maine, Martins (River)
USA: Maine, Troy (River)
Wales, Dee River (River)

This list may not be complete but is based on published studies.
  • J. R. E. Jones, A further ecological study of calcareous streams in the "Black Mountain" district of South Wales, J. Anim. Ecol. 18:142-159, from p. 157 (1949).
  • J. R. E. Jones, A further ecological study of the river Rheidol: the food of the common insects of the main-stream, J. Anim. Ecol. 19:159-174, from p. 172 (1950).
  • R. M. Badcock, 1949. Studies in stream life in tributaries of the Welsh Dee. J. Anim. Ecol. 18:193-208, from pp. 202-206 and Price, P. W., 1984, Insect Ecology, 2nd ed., New York: John Wiley, p. 23
  • Thompson, RM and Townsend CR. 2005. Energy availability, spatial heterogeneity and ecosystem size predict food-web structure in streams. OIKOS 108: 137-148.
  • Thompson, RM and Townsend, CR. 2003. Impacts on stream food webs of native and exotic forest: an intercontinental comparison. Ecology 84:145-161
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 887
Specimens with Sequences: 736
Specimens with Barcodes: 708
Species: 60
Species With Barcodes: 54
Public Records: 152
Public Species: 16
Public BINs: 26
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Leuctra sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Leuctra sp. SLB-2003

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGAGCTTGATCACGAATAGTAGGGACATCTTTAAGTCTTCTAATCCGAGCTGAACTAGGGCAACCTGGATCGCTAATTGGAGATGATCAAATTTATAATGTTATTGTAACAGCCCACGCTTTTGTGATAATTTTTTTTATGGTTATGCCTATTATAATTGGAGGGTTCGGAAATTGATTAGTTCCCCTAATATTAGGGGCCCCAGATATAGCCTTCCCTCGAATAAATAACATGAGTTTTTGACTCTTGCCTCCTTCATTGACTCTCTTACTTGCCAGTAGTATAGTGGAAAATGGGGCAGGGACTGGTTGAACAGTTTACCCCCCACTAGCCGCAGGTATTGCTCATGCAGGGGCTTCCGTTGACTTAGCAATCTTTTCATTGCATTTAGCAGGAGTATCATCCATTTTAGGGGCTGTAAATTTTATTACTACAGTAATTAATATACGATCAAGCGGAATAACATTAGACCGAATACCATTATTTGTTTGGGCGGTTGTTATTACAGCTCTATTACTCCTCCTATCTTTACCAGTTCTTGCAGGAGCAATCACTATATTATTGACTGACCGAAATTTAAATACCTCCTTTTTTGACCCAGCAGGAGGGGGAGACCCTATTCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Leuctra sp. SLB-2003

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Leuctra NS-2

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Leuctra NS-1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Leuctra XZ sp. NB1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!