Serrivomer beanii &amp;mdash; Details

Distribution

European waters (ERMS scope), Gulf of Maine, Gulf of St. Lawrence, North West Atlantic, Reunion, South Africa (country)

North-West Atlantic Ocean species (NWARMS) http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
van der Land, J.; Costello, M.J.; Zavodnik, D.; Santos, R.S.; Porteiro, F.M.; Bailly, N.; Eschmeyer, W.N.; Froese, R. (2001). Pisces, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 357-374 http://www.marbef.org/data/aphia.php?p=sourcedetails&id=1411
Nozères C., Archambault D., Chouinard P.-M., Gauthier J., Miller R., Parent E., Schwab P., Savard L., and Dutil J.-D. 2010. Identification guide for marine fishes of the estuary and northern Gulf of St. Lawrence and sampling protocols used during trawl surveys between 2004 and 2008. Can. Tech. Rep. Fish. Aquat. Sci. 2866: xi + 243 p http://www.marinespecies.org/aphia.php?p=sourcedetails&id=145051
Johnson CL, Runge JA, Curtis KA, Durbin EG, Hare JA, Incze LS, Link J, Melvin GD, O'Brien TD, Van Guelpen, L (in revision) Biodiversity and ecosystem function in the Gulf of Maine: pattern and role of zooplankton and pelagic nekton. PLoS One. http://www.vliz.be/vmdcdata/masdea/masdea.php?p=sourcedetails&id=148111
Miller, Roberta. 2012. The museum collection database, Fisheries and Oceans Canada digital collections, Maurice Lamontagne Institute, Quebec http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=163928

Creative Commons Attribution 3.0 (CC BY 3.0)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic Ocean: on both sides, between 60°N and 20°S (Ref. 5237); in the eastern Atlantic, reported to range further north to Iceland (Ref. 12462) and further south to off the Cape and Natal in South Africa (Ref. 5236). Indian Ocean: Reunion (Ref. 33390). Western Pacific: Australia (Ref. 7300).

Castle, P.H.J. 1986 Serrivomeridae. p. 191. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 5236) http://www.fishbase.org/references/FBRefSummary.php?id=5236&speccode=7477

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

between 60°N and 20°S

North-West Atlantic Ocean species (NWARMS) http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic; Indian Ocean (including Mascarenes).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 780 mm TL

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

78.0 cm TL (male/unsexed; (Ref. 5236))

Castle, P.H.J. 1986 Serrivomeridae. p. 191. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 5236) http://www.fishbase.org/references/FBRefSummary.php?id=5236&speccode=7477

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Head, abdomen and tail brown to black or silvery (Ref. 5236). Snout beak-like (Ref. 13608).

Castle, P.H.J. 1986 Serrivomeridae. p. 191. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 5236) http://www.fishbase.org/references/FBRefSummary.php?id=5236&speccode=7477

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Serrivomer beanii Gill & Ryder
Catalog Number: USNM 33383
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1883
Locality: Nantucket To Cape Sable, N.S., Massachusetts, United States, Atlantic
Depth (m): 1564 to 1564
Vessel: Albatross

Holotype: Gill, T. N. & Ryder, J. A. 1883. Proceedings of the United States National Museum. 6 (381): 261.

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

bathypelagic; marine; depth range 0 - 5998 m (Ref. 58426)

Coad, B.W. and J.D. Reist 2004 Annotated list of the arctic marine fishes of Canada. Can. MS Rep. Fish Aquat. Sci. 2674:iv:+112 p. (Ref. 58426) http://www.fishbase.org/references/FBRefSummary.php?id=58426&speccode=10003

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic

North-West Atlantic Ocean species (NWARMS) http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occasionally found in Canadian Atlantic waters at depths of 850- 925 m.

North-West Atlantic Ocean species (NWARMS) http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 234 specimens in 1 taxon.
Water temperature and chemistry ranges based on 213 samples.

Environmental ranges
  Depth range (m): 4.5 - 4000
  Temperature range (°C): 2.336 - 22.962
  Nitrate (umol/L): 0.122 - 34.674
  Salinity (PPS): 34.017 - 36.618
  Oxygen (ml/l): 1.958 - 6.575
  Phosphate (umol/l): 0.028 - 2.284
  Silicate (umol/l): 0.799 - 59.793

Graphical representation

Depth range (m): 4.5 - 4000

Temperature range (°C): 2.336 - 22.962

Nitrate (umol/L): 0.122 - 34.674

Salinity (PPS): 34.017 - 36.618

Oxygen (ml/l): 1.958 - 6.575

Phosphate (umol/l): 0.028 - 2.284

Silicate (umol/l): 0.799 - 59.793

Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Public Domain

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 850 - 925m.
From 850 to 925 meters.

Habitat: bathypelagic. Exhibits vertical migrations during the night. Feeds on shrimps, other crustaceans and small fishes (Ref. 6722).

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Epibenthic-pelagic (Ref. 58426). Exhibits vertical migrations during the night. Feeds on shrimps, other crustaceans and small fishes (Ref. 6722). Eaten by large fish, such as cod (Ref. 5951).

Saldanha, L. and E. Karmovskaya 1990 Serrivomeridae. p. 169-171. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI, Paris; and UNESCO, Paris. Vol. 1. (Ref. 5237) http://www.fishbase.org/references/FBRefSummary.php?id=5237&speccode=7477

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Serrivomer beanii

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACCCGCTGATTCTTTTCTACTAATCACAAAGACATTGGTACCCTATATCTAGTATTTGGTGCCTGAGCCGGAATGGTGGGCACTGCATTAAGCCTACTAATCCGTGCTGAACTAAGCCAACCTGGCGCCCTTCTTGGAGATGATCAAATTTACAATGTTATTGTTACAGCACATGCGTTTGTAATAATTTTCTTTATAGTAATACCAGTAATAATTGGTGGATTCGGCAACTGACTTGTACCCCTAATGATCGGAGCCCCAGACATGGCATTCCCTCGAATAAATAACATAAGCTTCTGACTCCTCCCCCCCTCATTTCTCTTACTACTGGCATCCTCTGGGGTAGAAGCCGGAGCTGGGACAGGTTGAACTGTATACCCCCCTCTAGCCGGAAACTTGGCCCACGCTGGAGCATCAGTTGACTTAACAATTTTCTCACTTCACCTTGCAGGGATCTCATCAATTCTAGGGGCAATTAACTTTATTACCACAATCATTAATATGAAACCGCCTGCCATTACCCAGTATCAAACCCCTTTATTCGTGTGATCTGTCCTAGTGACTGCAGTACTACTTCTGCTGTCTCTGCCAGTTCTCGCTGCAGGAATCACAATACTTCTAACCGATCGAAACCTAAACACAACATTCTTTGACCCTGCAGGAGGAGGAGACCCAATCCTGTACCAACACCTTTTCTGATTCTTTGGTCACCCAGAAGTGTACATTTTAATTTTACCCGGATTTGGAATAATCTCCCACATCGTCGCCTATTATTCAGGTAAAAAAGAACCCTTCGGCTATATAGGAATGGTCTGAGCAATGATGGCTATCGGACTCCTAGGATTTATCGTATGAGCACATCACATATTCACAGTGGGAATAGACGTAGACACTCGTGCTTATTTTACTTCCGCCACAATAATTATCGCTATCCCAACCGGGGTAAAAGTGTTTAGCTGATTAGCCACACTCCACGGCGGAGTAGTTAAATGAGAAACACCCCTCCTCTGGGCCTTAGGCTTTATCTTCCTCTTCACAGTTGGGGGCCTAACAGGAATCGTACTAGCAAATTCGTCAATTGACATCGTACTACATGACACATACTATGTGGTAGCCCACTTCCACTATGTATTGTCTATAGGAGCAGTATTCGCCATCATGGGGGGCTTTGTGCACTGATTCCCGCTATTTTCAGGTTACACATTACATGACACCTGAACTAAAGTCCACTTCGGTATTATATTCCTGGGGGTAAATCTAACATTCTTTCCACAGCACTTCCTAGGTCTTGCAGGAATACCACGACGTTATTCAGACTACCCAGACGCATACACCCTATGAAATACAATTTCATCTATCGGCTCCCTAATTTCTCTCACGGCAGTAGTCTTATTCCTATTTATTTTATGAGAAGCATTTAGCGCAAAACGAGAAGTAAAATGAGTAGAGTTGACAGAAACAAATGTTGAATGACTTCACGGATGTCCTCCCCCGTATCACACATACGAAGAACCCGCATATGTACGAGTTCAACAACCATTCACTAAGTTAATAATTTAA
-- end --

Download FASTA File

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Serrivomer beanii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 29
Species With Barcodes: 1

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated

IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006. http://www.fishbase.org/references/FBRefSummary.php?id=57073

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest

Castle, P.H.J. 1986 Serrivomeridae. p. 191. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 5236) http://www.fishbase.org/references/FBRefSummary.php?id=5236&speccode=7477

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5