Overview

Comprehensive Description

Description

Thelepus cincinnatus (Fabricius).

 

Amphitrite cincinnatus Fabricius, 1780 ; Thelepus c. Malmgren, 1865, p. 387; T. antarcticus Willey, 1902, p. 278, pl. XLV, fig. 6 (nec Kinberg) ; T. antarcticus Benham, 1921, p. 91; T. cincinnatus Hessle, 1917, p. 212 (with full literature).

 

In the account of that species of Thelepus with two pairs of which occurred
in great numbers in the " Aurora " collection from Commonwealth Bay, I referred it to T. antarcticus to which Kinberg ascribed only two pairs of gills. Hessle has since examined the type of that species and finds that it possesses a third pair, which Kinberg seems to have overlooked. Consequently this antarctic worm is not that species. As I indicated in my report on the " Aurora " worm, this antarctic species is very similar to the northern T. cincinnatus Fabr., as Willey has pointed out, but there seem to be a few differences judging by the recent account given by McIntosh.

 

Hessle has had the opportunity of studying a large series of this form both from the Arctic Seas and from Graham's Land, and he writes " Trotz sorgfältiger Bemühungen habe ich keinen einzigen konstanten Unterschied zwischen den arktischen and antarktischen Exemplaren gefunden."

 

As I noted. I was unable to find any specimen with three pairs of gills, such as Fauvel had suggested might occur as a variation ; and in the present lot there is in every case only two pairs of gills, so that we may regard the possibility of such a variation as excluded.

 

In striking contrast to the very great abundance of this worm in Adelie Land is the paucity of specimens gathered during the expedition to McMurdo Sound, from which only some dozen tubes—some of them empty—were collected ; these are all of small size and the only large one comes from Cape Adare in the same region as that recorded by Willey. This large individual reached me without its tube. It is not nearly of the size commonly attained by those at Commonwealth Bay.

 

As I had not paid attention to the nephridial papillae when making that report, I take this opportunity of supplementing that account. Hessle, who has investigated the distribution of the nephridia in the various genera of Terebellids, does not describe the position of the papillae in all cases. This individual is a male, filled with sperm morulae ; there are four papillae on each side in the usual position on the chaetigerous segments 2, 3, 4, and 5, but the last is scarcely noticeable. These papillae are relatively smaller than one would expect for a worm of this size, but this is explained, I think, by the highly glandular character of the skin, by reason of which the papillae do not project as far as in worms in which this thickening is absent. I am able, also, to give the facts about the female for, owing to the kindness of the Trustees of the Australian Museum, I have some specimens at hand from the former expedition. In a female the papillae are depressed, glandular and very difficult to see, so closely do they resemble the surrounding tissue ; unless searched for, they would be overlooked. However, on the segments 3, 4, and 5 the region between notopod and neuropodial torus is of a paler hue and smoother than the surrounding body-wall ; the papillae have the same position and appearance as in other genera.

 

The worm attains sexual maturity while still of small size, for, in one measuring 55 mm. in length, excluding the tentacles, I find the body cavity filled with eggs.

 

In this and other smaller worms the glandular dorsal surface differs in appearance from that noted in the larger individuals. Each segment is marked by a transverse row of large circular translucent spots, with smaller ones interspersed amongst them ; this glandular dorsal region is very distinctly marked off at the sides, and stands up as a sort of cushion extending from side to side, but not reaching the notopods. It lacks the roughness of the larger forms. I notice that Hessle has a statement to the same effect. In the tubes of this species, the basal membrane which supports the sand grains is often seen when the worm is within ; for the wall of the tube is stretched and the sand grains appear arranged in transverse or circular lines round the tube.

 

Some of the tubes have, as usual, foreign bodies of various sorts attached. In the specimen from Station 348 portions of the calcareous Polyzoan Salicornaria are attached, mostly horizontally and projecting beyond the edge of the tube.

 

Localities.—Cape Adare, Station 220, depth 45-50 fathoms. McMurdo Sound, Stations 314, 316, 348, 355, in depths of 200-300 fathoms.

 

Distribution.—In the Antarctic and Arctic Seas ; Mediterranean ; warmer and colder parts of the Atlantic ; Japan.”

 

(Benham, 1927)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© National Museum of Natural History, Smithsonian Institution

Source: Antarctic Invertebrates Website (NMNH)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Gulf of St. Lawrence (unspecified region), Saguenay Fjord, southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: eastern Bradelle Valley), downstream part of middle St. Lawrence estuary, lower St. Lawrence estuary, Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway), upper North Shore (between Sept- Iles to Pointe des Monts), upper Laurentian Channel (bathyal zone off Sept- Iles); lower North Shore; Cobscook Bay
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Type for Thelepus crassibranchiatus Treadwell, 1901
Catalog Number: USNM 16114
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Year Collected: 1899
Locality: Mayaguez Harbor, Off Custom House, Puerto Rico, Caribbean Sea, North Atlantic Ocean
Depth (m): 402 to 411
Vessel: Fish Hawk R/V
  • Type: Loñdono-Mesa, M. H. 2009. Terebellidae (Polychaeta: Terebellida) from the Grand Caribbean region. Zootaxa. 2320: 1-93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

bathyal, infralittoral and circalittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 252 specimens in 1 taxon.
Water temperature and chemistry ranges based on 147 samples.

Environmental ranges
  Depth range (m): 0 - 3138
  Temperature range (°C): -1.714 - 12.863
  Nitrate (umol/L): 2.853 - 36.002
  Salinity (PPS): 32.282 - 35.751
  Oxygen (ml/l): 3.560 - 7.743
  Phosphate (umol/l): 0.414 - 2.378
  Silicate (umol/l): 2.391 - 127.607

Graphical representation

Depth range (m): 0 - 3138

Temperature range (°C): -1.714 - 12.863

Nitrate (umol/L): 2.853 - 36.002

Salinity (PPS): 32.282 - 35.751

Oxygen (ml/l): 3.560 - 7.743

Phosphate (umol/l): 0.414 - 2.378

Silicate (umol/l): 2.391 - 127.607
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thelepus cincinnatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 19 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCACACTCTACTTTATTTTTGGTGTATGAGGAGGACTTTTAGGTACCTCTATAAGACTCCTCATTCGTATCGAACTAGGTCAACCAGGAAGATGACTTGGTAGAGACCAACTCTATAATACTATTGTAACCGCTCATGCCCTCTTAATAATCTTTTTCATAGTAATACCAATCTTTATTGGAGGATTTGGTAACTGATTAATCCCATTAATACTATCTGCCCCTGATATAGCTTTCCCACGAATAAATAACATAAGATTCTGACTTCTACCCCCTTCACTCCTTCTTCTATTAAGCTCCGCCGCCGTAGAAAAAGGTGCAGGAACAGGATGAACGTTATATCCTCCCCTATCAAGAAATATAGCCCATGCAGGACCCTCTGTAGATCTAGCTATTTTCTCCCTTCACCTTGCTGGTGCTTCATCTATTATAGCCTCAGTTAATTTTATCTCCACTATTTTTAATTGTCGTATTAAAGGTATACGATTAGAACGTATCCCTCTTTTTGTATGAGCTGTTTTAATTACAACTATTCTGCTTCTTCTCTCACTCCCTGTTCTTGCAGGTGCTATTACTATACTCCTCACCGACCGAAATATTAATACAGCCTTCTTTGATCCTAGAGGAGGAGGAGACCCTATTCTATTTCAACATCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thelepus cincinnatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 39
Specimens with Barcodes: 45
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!