Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

WhyReef - Lifestyle

The bullethead parrotfish spends its days swimming over the reef and eating, using its strong, beak-like mouth to scrape algae off of rocks and dead coral. Its mouth is even strong enough to munch on coral! When bullethead parrotfish are young they swim in groups, but as adults they are usually swim alone. All bullethead parrotfish are born female; only some will become male later in life.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

One of the most widespread parrotfishes, but highly variable and some geographical forms that are probably subspecific (Ref. 48636). Inhabit both coral rich (Ref. 58652) and open pavement areas of shallow reef flats and lagoon and seaward reefs (Ref. 5213), as well as drop-offs, behaving differently in various areas (Ref. 48636). Benthopelagic (Ref. 58302). Juveniles found in coral rubble areas of reef flats and lagoons (Ref. 9710). Juveniles and individuals in the initial phase form large groups that migrate great distances between feeding and sleeping grounds (Ref. 9710). Feed on benthic algae (Ref. 30573). Minimum depth range reported taken from Ref. 30874. Protogynous (Ref. 55080). Minimum depth from Ref. 58018.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Fun Facts

The bullethead parrotfish is one of the most colorful fish on the reef, as well as one of the most common! At night, when it is sleeping, it has a special way of protecting itself from predators: hiding under a coral ledge and then spewing up a sac of mucous that hides its scent, or smell, so predators can’t detect it. It then sleeps inside this mucous sac until morning.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is found from the Red Sea, to the Gulf of Aden, Oman, Persian Gulf, Pakistan and India. In East Africa it is found to KwaZulu-Natal, South Africa, eastwards to Madagascar, western Thailand, southwest Sumatra, Java, Cocos and Christmas Island.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: Red Sea south to Natal, South Africa (Ref. 5490) and east to the Hawaiian, Line, and Ducie islands, north to the Ryukyu Islands, south to Perth, New South Wales, Lord Howe Island and Rapa Island.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Madagascar and Mascarenes east to Hawaiian Islands and Pitcairn Group, north to Ryukyu Islands and Ogasawara Islands, south to Western Australia, New Caledonia, Lord Howe Island and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 400 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

40.0 cm TL (male/unsexed; (Ref. 2334))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Initial phase very variable in coloration. Small individuals may be uniformly dark brown to light gray with or without the dark-centered light area on the caudal peduncle; large individuals may have a series of irregular rows of small light spots posteriorly or have the dark-centered light area on the caudal peduncle. The terminal phase is also variable with or without a large tan area on the side or on the caudal peduncle. Rounded snout (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Neotype for Chlorurus sordidus
Catalog Number: USNM 202297
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): H. Fehlmann, G. El Sherbini & A. Mahmoud
Year Collected: 1965
Locality: U.A.R.: Red Sea, Strait of Jubal, NW edge of Sha'b al Fanadir reef., Egypt, Strait of Jubal, Red Sea, Indian
Depth (m): 6
Vessel: Anton Bruun
  • Neotype: Schultz, L. P. 1969. Smithsonian Contributions to Zoology. No. 17: 20.; Forsskal, P. 1775. Descriptiones animalium, avium, amphibiorum, piscium, insectorum, vermium. 30.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Chlorurus sordidus
Catalog Number: USNM 51756
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa, Apia., Upolu, Samoa, Samoa Islands, Pacific
  • Type: Jordan, D. S. & Seale, A. 1906. Bulletin of the United States Bureau of Fisheries. 25 (for 1905): 330, fig. 63.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Chlorurus sordidus
Catalog Number: USNM 154672
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): A. Seale
Year Collected: 1900
Locality: Guam: Agana, Guam, Mariana Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is a small species with an average length of ~15 cm TL over its range. The maximum size was recorded at 26 cm (TL) but achieves 39 cm (TL) in Musudam Peninsula, Oman. The maximum age recorded was 14 yrs (Oman). In the central Indian Ocean, the maximum age recorded was 8 years (J.H. Choat pers comm. 2009). Juveniles recruit into sheltered reef environments including seagrass beds (Heemstra and Heemstra 2004). It forms schools of 50 or more.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; oceanodromous (Ref. 51243); brackish; marine; depth range 0 - 50 m (Ref. 5213)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)   http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683 External link.
  • Fischer, W., I. Sousa, C. Silva, A. de Freitas, J.M. Poutiers, W. Schneider, T.C. Borges, J.P. Feral and A. Massinga 1990 Fichas FAO de identificaçao de espécies para actividades de pesca. Guia de campo das espécies comerciais marinhas e de águas salobras de Moçambique. Publicaçao preparada em collaboraçao com o Instituto de Investigaçao Pesquiera de Moçambique, com financiamento do Projecto PNUD/FAO MOZ/86/030 e de NORAD. Roma, FAO. 1990. 424 p. (Ref. 5213)   http://www.fishbase.org/references/FBRefSummary.php?id=5213&speccode=151 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 180 specimens in 1 taxon.
Water temperature and chemistry ranges based on 158 samples.

Environmental ranges
  Depth range (m): 0.4575 - 57
  Temperature range (°C): 22.496 - 29.336
  Nitrate (umol/L): 0.047 - 2.714
  Salinity (PPS): 32.279 - 36.148
  Oxygen (ml/l): 4.438 - 5.079
  Phosphate (umol/l): 0.057 - 0.507
  Silicate (umol/l): 0.721 - 4.752

Graphical representation

Depth range (m): 0.4575 - 57

Temperature range (°C): 22.496 - 29.336

Nitrate (umol/L): 0.047 - 2.714

Salinity (PPS): 32.279 - 36.148

Oxygen (ml/l): 4.438 - 5.079

Phosphate (umol/l): 0.057 - 0.507

Silicate (umol/l): 0.721 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 3 - 50m.
From 3 to 50 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occur inshore (Ref. 75154). One of the most widespread parrotfishes, but highly variable and some geographical forms that are probably subspecific (Ref. 48636). Inhabit both coral rich (Ref. 58652) and open pavement areas of shallow reef flats and lagoon and seaward reefs (Ref. 5213), as well as along drop-offs, behaving differently in various areas (Ref. 48636). Juveniles found in coral rubble areas of reef flats and lagoons (Ref. 9710). Juveniles and individuals in the initial phase form large groups that migrate great distances between feeding and sleeping grounds (Ref. 9710). Feed on benthic algae (Ref. 30573). Minimum depth range reported taken from Ref. 30874.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

WhyReef - Menu

Bullethead parrotfish eat turf algae and calcareous algae (like Halimeda tuna). It also munches on corals, snails, and tiny animals in the water called zooplankton. Because it eats both plants and animals, the bullethead parrotfish is an omnivore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Size at sex change: 35.1 - 47.2 cm TL (Ref. 55080).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Chlorurus sordidus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Chlorurus sordidus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACACGCTGATTCTTCTCAACAAACCATAAAGACATCGGTACCCTCTACCTTGTATTTGGTGCCTGAGCCGGAATAGTAGGCACTGCTTTAAGCCTCCTAATCCGAGCTGAATTAAGCCAACCCGGGGCCCTTCTCGGCGACGATCAGATTTATAATGTTATCGTTACAGCCCATGCATTTGTAATGATCTTTTTTATAGTCATGCCCATCATGATTGGAGGTTTCGGAAATTGACTCATCCCACTTATGATCGGAGCACCCGACATGGCCTTCCCCCGAATGAACAATATAAGCTTCTGACTTCTCCCGCCTTCCTTCCTCCTTCTACTCGCCTCCTCTGGCGTAGAAGCAGGGGCAGGAACCGGATGAACTGTTTACCCCCCACTAGCCGGAAATCTTGCACACGCGGGTGCATCCGTTGATCTGACAATTTTCTCCCTTCACTTAGCAGGAATCTCTTCGATCCTAGGGGCAATTAACTTTATCACAACTATCATCAACATGAAACCCCCTGCCATCTCCCAATACCAGACCCCCCTCTTCGTGTGAGCTGTTTTAATCACTGCCGTACTGCTTCTTCTCTCACTTCCTGTTCTCGCTGCAGGAATCACAATGCTATTAACAGATCGAAATCTAAACACTACCTTCTTCGATCCTGCAGGCGGAGGAGACCCCATCCTTTATCAACACCTATTCTGATTCTTTGGTCACCCAGAGGTCTACATCCTAATCCTTCCAGGCTTTGGTATGATTTCTCATATTGTTGCCTACTACTCAGGGAAAAAAGAACCCTTCGGTTACATGGGTATAGTCTGAGCCATGATGGCCATCGGCTTACTTGGCTTCATTGTTTGAGCTCACCACATGTTCACTGTTGGGATGGACGTTGATACTCGGGCATACTTTACATCTGCTACAATGATTATTGCCATTCCAACTGGGGTCAAAGTCTTTAGCTGACTAGCCACCCTTCACGGAGGCTCAATTAAATGAGAAACTCCGCTTCTTTGAGCTCTAGGCTTCATCTTCCTATTCACAGTTGGAGGCCTAACCGGAATTGTTCTAGCCAACTCATCACTAGATATTGTCCTTCACGACACGTACTACGTAGTCGCCCACTTCCACTACGTCCTATCTATGGGAGCTGTCTTTGCCATTGTCGCAGCCTTCGTGCACTGGTTCCCCCTCTTTACAGGCTACACCCTTCATCCAACCTGAACAAAAATCCACTTTGGGGTAATGTTTGTAGGTGTAAACTTAACCTTCTTCCCTCAACACTTCCTAGGACTAGCAGGCATGCCTCGACGATACTCAGACTATCCAGACGCCTATACCCTGTGAAATACCATCTCCTCAATTGGCTCCCTAATCTCACTAGTTGCAGTAATCATGTTTTTATTCATTATTTGAGAAGCATTCACCGCAAAACGTGAAGTTATGTCAGTAGAGCTAACATCAACAAACATTGAGTGACTGCACGGCTGCCCTCCCCCATACCACACATTCGAAGAACCCGCATTCGTTCAAGTTCAGACAAACT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Choat, J.H., Carpenter, K.E., Clements, K.D., Rocha, L.A., Russell, B., Myers, R., Lazuardi, M.E., Muljadi, A., Pardede, S. & Rahardjo, P.

Reviewer/s
McIlwain, J. & Craig, M.T.

Contributor/s

Justification
This species is one of the most widespread and abundant of the Indian Ocean parrotfishes. Its small size precludes targeted fishing and it is found in marine protected areas in parts of its range. It is therefore listed as Least Concern.

History
  • 2010
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is abundant in all reef environments investigated (Randall and Bruce 1983). In the central Indian Ocean at the Seychelles and Cocos Island, densities range from 15-180 adults per 1,000 m2. In the Arabian Gulf, it extends to Bahrain. It may occur in the northern Gulf but is extremely rare. It is rare in the Musandum Peninsula and the Arabian Gulf, densities range from 2-8 adults per 1,000 m2 (J.H. Choat pers comm. 2009).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species.

Parrotfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reefs, while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. Although the majority of the parrotfishes occur in mixed habitat (primarily inhabiting seagrass beds, mangroves, and rocky reefs) approximately 78% of these mixed habitat species are experiencing greater than 30% loss of coral reef area and habitat quality across their distributions. Of those species that occur exclusively in coral reef habitat, more than 80% are experiencing a greater than 30% of coral reef loss and degradation across their distributions. However, more research is needed to understand the long-term effects of habitat loss and degradation on these species populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that depend on live coral reefs for food and shelter especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats. Furthermore, coral reef loss and declining habitat conditions are particularly worrying for some corallivorous excavating parrotfishes that play major roles in reef dynamics and sedimentation (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Threats

Reefs are in danger, and that means so is the home of the bullethead parrotfish!
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Chlorurus sordidus

Chlorurus sordidus, known commonly as the daisy parrotfish or bullethead parrotfish, is a species of marine fish in the family Scaridae.

The daisy parrotfish is widespread throughout the tropical waters of the Indo-Pacific region, Red Sea included.[2]

The daisy parrotfish is a medium size fish and can reach a maximum size of 40 cm length.[3]

References[edit]

  1. ^ Choat, J.H., Carpenter, K.E., Clements, K.D., Rocha, L.A., Russell, B., Myers, R., Lazuardi, M.E., Muljadi, A., Pardede, S. & Rahardjo, P. 2012. Chlorurus sordidus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 11 September 2013.
  2. ^ "Facts about Bullethead Parrotfish (Chlorurus sordidus) - Encyclopedia of Life". Eol.org. 2013-09-11. Retrieved 2013-11-12. 
  3. ^ "Chlorurus sordidus, daisy parrotfish : fisheries, aquarium". Fishbase.org. 2012-07-03. Retrieved 2013-11-12. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!