Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) It occurs from Manitoba to Quebec in Canada and Maine south to Tennessee in the U.S. (STark, 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: Stark (2004) cites Connecticut, Kentucky, Massachusetts, Maine, North Carolina, New Hampshire, New Jersey, New York, Ohio, Pennsylvania, South Carolina, Tennessee, Virginia, and West Virginia, and Manitoba, Ontario, and Quebec in Canada.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acroneuria carolinensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGGTGCATGAGCTGGCATAGTGGGGACTTCTCTGAGTCTTCTTATTCGTGCTGAACTCGGCCAACCCGGCTCACTCATTGGAGATGATCAAATCTATAATGTCATCGTAACGGCTCACGCCTTTGTAATAATTTTCTTCATAGTAATACCGATTATAATTGGRGGGTTCGGRAATTGATTGGTACCTCTTATACTAGGGGCCCCAGATATAGCTTTCCCTCGAATAAACAATATAAGTTTTTGACTATTACCTCCTTCCTTAACATTATTACTAGCCAGCAGCTTAGTTGAAAACGGAGCGGGCACTGGTTGAACCGTCTACCCTCCCCTCTCAGCAGGAATTGCTCATGCCGGAGCCTCTGTTGACATGGCTATTTTCTCCTTACATTTGGCGGGAGTATCCTCCATTTTAGGGGCTGTAAATTTTATTACCACAGTTATTAATATACGATCAGCAGGGATAACCCTAGACCGTATACCTCTTTTTGTATGAGCAGTGGCTATCACAGCTCTATTGCTCCTACTTTCCCTTCCAGTTCTTGCCGGAGCAATCACCATGCTTCTGACAGACCGGAACCTAAATACTTCATTTTTTGACCCTGCCGGAGGGGGAGAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acroneuria carolinensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: It occurs from Manitoba to Quebec in Canada and Maine south to Tennessee in the U.S.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!