Ecology

Associations

Plant / associate
adult of Campyloneura virgula is associated with Trees
Remarks: season: 7-10

Plant / associate
adult of Campyloneura virgula is associated with Crataegus monogyna
Remarks: season: 7-10
Other: major host/prey

Plant / associate
adult of Campyloneura virgula is associated with Corylus avellana
Remarks: season: 7-10
Other: major host/prey

Plant / associate
adult of Campyloneura virgula is associated with Quercus (native spp)
Remarks: season: 7-10
Other: major host/prey

Animal / predator
adult of Campyloneura virgula is predator of Tetranychus urticae
Remarks: season: 7-10

Animal / predator
adult of Campyloneura virgula is predator of egg of Psocoptera
Remarks: season: 7-10

Animal / dung/debris feeder
adult of Campyloneura virgula feeds on dung/debris honeydew of Aphidoidea
Remarks: season: 7-10

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Campyloneura virgula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGAACAAATGATTATTTTCAACCAATCATAAAGATATTGGAACTCTTTATTTTATCATAGGAATATGAGCAGGGATACTCGGAACATCATTAAGATGAATTATTCGAATTGAACTTGGAAGACCCGGGTCTTTCATCGGAGATGATCAAACTTATAACGTAGTGGTTACTGCGCATGCATTTATCATAATTTTCTTCATAGTAATACCAATCATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATAATTGGAGCACCCGACATAGCATTTCCACGAATGAATAATATAAGATTCTGACTATTACCCCCATCAATCACCTTACTCATCATAAGTAGAATAGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTACCCTCCCCTATCCTCCAACCTCTCCCACAACGGAGCATCAGTAGATTTAGCCATCTTCTCCCTACATTTAGCAGGAGTATCATCAATTCTAGGGGCGGTAAACTTTATCTCNACAATCATTAATATACGACCTATAGGAATAACAGCTGACCGAATCCCATTATTTGTATGATCAGTAGGAATCACTGCCCTATTACTACTACTATCATTACCAGTTCTAGCTGGTGCTATCACCATACTACTAACAGACCGTAACTTTAACACATCATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Campyloneura virgula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Campyloneura virgula

Campyloneura virgula is a species of bugs in Miridae family. It is the only species in the genus Campyloneura Fieber, 1861.[1]

Description[edit]

Campyloneura virgula can reach a length of 4–5 millimetres (0.16–0.20 in).[2] Adults have pale translucent hemelytra,[3] a red stripe on the edge of a pale green pronotum, a yellow scutellum. a black head, long red-banded antennae and bright yellow cuneus that are tipped with dark red.[2] Legs are pale yellow.[3] Nymphs are yellow, with a red stripe on the edge of the pronotum.[4]

Biology and ecology[edit]

This common predatory bug hunts for small insects, as aphids and red mites.[5] Adults flight time is from July to October during which they could be found on numerous deciduous trees, on hazel, hawthorn and oak.[2] The adults overwinter [2] and nymphs appear in May.[3]

The peculiarity of this bug is that in almost all of its range males are extremeley rare, as C. virgula reproduces without mating (parthenogenesis). This characteristic has an exception in Sicily and in North Africa, where the males are commonly present and the species has a normal sexual reproduction.[6]

Distribution[edit]

This species is widespread in the Nearctic ecozone, in Europe and in the Mediterranean area up to Turkestan.[7] It has been introduced in the United States of America.[2][3]

References[edit]

  • Henry, Thomas J., and Richard C. Froeschner, eds. (1988), Catalog of the Heteroptera, or True Bugs, of Canada and the Continental United States
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!