Ecology

Associations

Plant / associate
adult of Campyloneura virgula is associated with Trees
Remarks: season: 7-10

Plant / associate
adult of Campyloneura virgula is associated with Crataegus monogyna
Remarks: season: 7-10
Other: major host/prey

Plant / associate
adult of Campyloneura virgula is associated with Corylus avellana
Remarks: season: 7-10
Other: major host/prey

Plant / associate
adult of Campyloneura virgula is associated with Quercus (native spp)
Remarks: season: 7-10
Other: major host/prey

Animal / predator
adult of Campyloneura virgula is predator of Tetranychus urticae
Remarks: season: 7-10

Animal / predator
adult of Campyloneura virgula is predator of egg of Psocoptera
Remarks: season: 7-10

Animal / dung/debris feeder
adult of Campyloneura virgula feeds on dung/debris honeydew of Aphidoidea
Remarks: season: 7-10

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Campyloneura virgula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGAACAAATGATTATTTTCAACCAATCATAAAGATATTGGAACTCTTTATTTTATCATAGGAATATGAGCAGGGATACTCGGAACATCATTAAGATGAATTATTCGAATTGAACTTGGAAGACCCGGGTCTTTCATCGGAGATGATCAAACTTATAACGTAGTGGTTACTGCGCATGCATTTATCATAATTTTCTTCATAGTAATACCAATCATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATAATTGGAGCACCCGACATAGCATTTCCACGAATGAATAATATAAGATTCTGACTATTACCCCCATCAATCACCTTACTCATCATAAGTAGAATAGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTACCCTCCCCTATCCTCCAACCTCTCCCACAACGGAGCATCAGTAGATTTAGCCATCTTCTCCCTACATTTAGCAGGAGTATCATCAATTCTAGGGGCGGTAAACTTTATCTCNACAATCATTAATATACGACCTATAGGAATAACAGCTGACCGAATCCCATTATTTGTATGATCAGTAGGAATCACTGCCCTATTACTACTACTATCATTACCAGTTCTAGCTGGTGCTATCACCATACTACTAACAGACCGTAACTTTAACACATCATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Campyloneura virgula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Campyloneura virgula

Campyloneura virgula is a species of bugs in Miridae family that can be found in the United Kingdom. The species nymph is yellow coloured with red eyes and antennae. Adult species have bright yellow cuneus that are tipped with dark red. Adults flight time is from July–October during which they could be found on hazel, hawthorn and oak.[1]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!