Ecology

Habitat

Depth range based on 1047 specimens in 15 taxa.
Water temperature and chemistry ranges based on 573 samples.

Environmental ranges
  Depth range (m): 0 - 773
  Temperature range (°C): -0.626 - 27.668
  Nitrate (umol/L): 0.289 - 32.159
  Salinity (PPS): 27.165 - 39.006
  Oxygen (ml/l): 4.006 - 8.208
  Phosphate (umol/l): 0.038 - 2.281
  Silicate (umol/l): 0.756 - 83.714

Graphical representation

Depth range (m): 0 - 773

Temperature range (°C): -0.626 - 27.668

Nitrate (umol/L): 0.289 - 32.159

Salinity (PPS): 27.165 - 39.006

Oxygen (ml/l): 4.006 - 8.208

Phosphate (umol/l): 0.038 - 2.281

Silicate (umol/l): 0.756 - 83.714
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ophelia limacinaCMC01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ophelia limacinaCMC01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Ophelia limacina CMC02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 47 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGGACTCTTTATTTTATCCTGGGGATGTGAGCTGGAATGAGTGGAACTGGGCTTAGTATCCTTATTCGTGCTGAGCTTGCACAGCCTGGGTCTCTACTTGGTAATGATCAAATTTATAATACCGTGGTTACTGCCCATGCATTTCTAATAATTTTTTTTCTAGTCATGCCAGTTTTTATTGGCGGGTTTGGTAACTGGCTCGTTCCTCTAATAGTGGTTGCTCCGGATATAGCATTTCCGCGAATGAATAATCTAAGGTTTTGACTACTACCGCCTTCTCTATCTCTACTTATTTTTTCTGCAGCAGTAGAAAAAGGGGCTGGAACCGGGTGGACTGTTTACCCTCCTCTCTCAGGTAATCAGACCCATGCTGGCCCTTCTGTTGATCTGGCGATTGTTTCTCTGCATCTTGCTGGGGTGTCTTCTATTCTAGGGGCAATAAACTTCATTACCACTGCAGGTAATATGCGGCCAGGTGCAATGCGCCTGGAACGTATGCCTCTGTTTGTTTGGTCTGTTAAGGTTACTGCATGACTTCTTGTCATTTCTCTGCCAGTTCTGGCTGGAGGGATTACTATGCTTCTAACTGATCGGAATCTAAATACTACATTTTTTGACCCGCTCGGGGGCGGGGACCCTATTCTTTACCAGCATCTTTTTNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ophelia limacina CMC02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 48
Specimens with Barcodes: 48
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Ophelia limacina CMC01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 50 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNGACTCTTTATTTTATCCTAGGGATATGAGCTGGAATAAGTGGAACTGGGCTAAGTATTCTTATTCGTGCTGAGCTTGCACAGCCTGGATCTCTACTTGGCAATGATCAGATTTATAATACTGTGGTTACTGCACATGCATTTCTAATGATTTTTTTTCTAGTTATACCAGTTTTTATTGGTGGGTTTGGTAATTGGCTTGTTCCTCTAATGGTAGTTGCCCCGGATATAGCATTTCCGCGAATGAATAATCTCAGGTTTTGACTACTACCTCCCTCTCTATCTCTTCTTATTTTTTCTGCCGCAGTAGAAAAAGGGGCTGGAACTGGGTGAACTGTTTACCCCCCTCTTTCAGGTAATCAGACCCATGCTGGTCCTTCTGTTGATCTGGCAATTGTTTCTCTACATCTTGCTGGGGTGTCATCTATTCTAGGGGCGATAAATTTTATTACCACTGCTGGTAACATGCGACCAGGTGCAATGCGCCTGGAACGTATACCTCTATTTGTTTGATCTGTTAAGGTTACTGCATGACTTCTTGTAATTTCTCTGCCAGTTCTGGCTGGGGGTATTACTATGCTCCTAACTGATCGAAATCTAAATACTACATTTTTCGACCCGCTTGGAGGTGGGGATCCTATTCTTTACCAACATCTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ophelia limacina CMC01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 49
Specimens with Barcodes: 49
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:106Public Records:101
Specimens with Sequences:105Public Species:4
Specimens with Barcodes:103Public BINs:4
Species:5         
Species With Barcodes:5         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Ophelia

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!