Ecology
Habitat
Depth range based on 1047 specimens in 15 taxa.
Water temperature and chemistry ranges based on 573 samples.
Environmental ranges
Depth range (m): 0 - 773
Temperature range (°C): -0.626 - 27.668
Nitrate (umol/L): 0.289 - 32.159
Salinity (PPS): 27.165 - 39.006
Oxygen (ml/l): 4.006 - 8.208
Phosphate (umol/l): 0.038 - 2.281
Silicate (umol/l): 0.756 - 83.714
Graphical representation
Depth range (m): 0 - 773
Temperature range (°C): -0.626 - 27.668
Nitrate (umol/L): 0.289 - 32.159
Salinity (PPS): 27.165 - 39.006
Oxygen (ml/l): 4.006 - 8.208
Phosphate (umol/l): 0.038 - 2.281
Silicate (umol/l): 0.756 - 83.714
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 573 samples.
Environmental ranges
Depth range (m): 0 - 773
Temperature range (°C): -0.626 - 27.668
Nitrate (umol/L): 0.289 - 32.159
Salinity (PPS): 27.165 - 39.006
Oxygen (ml/l): 4.006 - 8.208
Phosphate (umol/l): 0.038 - 2.281
Silicate (umol/l): 0.756 - 83.714
Graphical representation
Depth range (m): 0 - 773
Temperature range (°C): -0.626 - 27.668
Nitrate (umol/L): 0.289 - 32.159
Salinity (PPS): 27.165 - 39.006
Oxygen (ml/l): 4.006 - 8.208
Phosphate (umol/l): 0.038 - 2.281
Silicate (umol/l): 0.756 - 83.714
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Ophelia limacinaCMC01
The following is a representative barcode sequence, the centroid of all available sequences for this species.

No available public DNA sequences.
Download FASTA File
No available public DNA sequences.
Download FASTA File
Trusted
Statistics of barcoding coverage: Ophelia limacinaCMC01
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Trusted
Barcode data: Ophelia limacina CMC02
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 47 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 47 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GGGACTCTTTATTTTATCCTGGGGATGTGAGCTGGAATGAGTGGAACTGGGCTTAGTATCCTTATTCGTGCTGAGCTTGCACAGCCTGGGTCTCTACTTGGTAATGATCAAATTTATAATACCGTGGTTACTGCCCATGCATTTCTAATAATTTTTTTTCTAGTCATGCCAGTTTTTATTGGCGGGTTTGGTAACTGGCTCGTTCCTCTAATAGTGGTTGCTCCGGATATAGCATTTCCGCGAATGAATAATCTAAGGTTTTGACTACTACCGCCTTCTCTATCTCTACTTATTTTTTCTGCAGCAGTAGAAAAAGGGGCTGGAACCGGGTGGACTGTTTACCCTCCTCTCTCAGGTAATCAGACCCATGCTGGCCCTTCTGTTGATCTGGCGATTGTTTCTCTGCATCTTGCTGGGGTGTCTTCTATTCTAGGGGCAATAAACTTCATTACCACTGCAGGTAATATGCGGCCAGGTGCAATGCGCCTGGAACGTATGCCTCTGTTTGTTTGGTCTGTTAAGGTTACTGCATGACTTCTTGTCATTTCTCTGCCAGTTCTGGCTGGAGGGATTACTATGCTTCTAACTGATCGGAATCTAAATACTACATTTTTTGACCCGCTCGGGGGCGGGGACCCTATTCTTTACCAGCATCTTTTTNN
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Ophelia limacina CMC02
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 48
Specimens with Barcodes: 48
Species With Barcodes: 1
Public Records: 48
Specimens with Barcodes: 48
Species With Barcodes: 1
Trusted
Barcode data: Ophelia limacina CMC01
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 50 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 50 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
NNGACTCTTTATTTTATCCTAGGGATATGAGCTGGAATAAGTGGAACTGGGCTAAGTATTCTTATTCGTGCTGAGCTTGCACAGCCTGGATCTCTACTTGGCAATGATCAGATTTATAATACTGTGGTTACTGCACATGCATTTCTAATGATTTTTTTTCTAGTTATACCAGTTTTTATTGGTGGGTTTGGTAATTGGCTTGTTCCTCTAATGGTAGTTGCCCCGGATATAGCATTTCCGCGAATGAATAATCTCAGGTTTTGACTACTACCTCCCTCTCTATCTCTTCTTATTTTTTCTGCCGCAGTAGAAAAAGGGGCTGGAACTGGGTGAACTGTTTACCCCCCTCTTTCAGGTAATCAGACCCATGCTGGTCCTTCTGTTGATCTGGCAATTGTTTCTCTACATCTTGCTGGGGTGTCATCTATTCTAGGGGCGATAAATTTTATTACCACTGCTGGTAACATGCGACCAGGTGCAATGCGCCTGGAACGTATACCTCTATTTGTTTGATCTGTTAAGGTTACTGCATGACTTCTTGTAATTTCTCTGCCAGTTCTGGCTGGGGGTATTACTATGCTCCTAACTGATCGAAATCTAAATACTACATTTTTCGACCCGCTTGGAGGTGGGGATCCTATTCTTTACCAACATCTTT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Ophelia limacina CMC01
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 49
Specimens with Barcodes: 49
Species With Barcodes: 1
Public Records: 49
Specimens with Barcodes: 49
Species With Barcodes: 1
Trusted
Statistics of barcoding coverage
Barcode of Life Data Systems (BOLD) Stats
| Specimen Records: | 106 | Public Records: | 101 |
| Specimens with Sequences: | 105 | Public Species: | 4 |
| Specimens with Barcodes: | 103 | Public BINs: | 4 |
| Species: | 5 | ||
| Species With Barcodes: | 5 | ||
Trusted
Barcode data
Trusted
Locations of barcode samples
Collection Sites: world map showing specimen collection locations for Ophelia

Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
