Overview

Brief Summary

The mullein bug, Campylomma verbasci, is a mirid (hemipteran) pest of apple and pear orchards. The early nymph stages of the mullein bug cause damage by feeding on flower calyx (petal sepals) and on young fruit (those generally less than 15mm), causing “stings”, raised pimple-like warts, which in large numbers can deform the apple. Apples, especially golden delicious, are more susceptible than pears to damage from C. vervasci. While the mullein bug has 3-4 generations per year, it is only the first generation of nymphs each season that causes damage. Most individuals in the subsequent generations migrate from orchards to herbaceous weeds, most commonly mullein (Verbascum thapsus L.). During the rest of the summer the mullein bug still does occur in orchards (albeit in smaller numbers), but after petal fall is no longer much threat to apple production. In fact, at this stage the mullein bug becomes a beneficial predator of mites, aphids, psyllids, thrips, and other small arthropod pests in orchards. Adults and nymphs remaining in the orchards may sometimes attack and cause damage to vegetative portions of fruit trees, but it is thought that this damage occurs only when an inadequate supply of prey arthropods is present. In the fall, C. vervasci adults migrate back to the orchards from their mullein hosts to mate and lay eggs to overwinter on tree bark.

The mullein bug is tolerant to many pesticides. When necessary, pesticide treatments are used on the first generation, in the narrow window after overwintered eggs hatch and before fruit predation occurs.

(Reding et al. 2001; Higbee; Alston and Reding 2011)

  • Alston, D. and M. E. Reding, 2011. Campylomma Bug (Campylomma verbasci). Utah State University, cooperative extension. Retrieved October 14, 2011 from http://utahpests.usu.edu/ipm/htm/fruits/fruit-insect-disease/campylomma-bug97" target="_blank">http://utahpests.usu.edu/ipm/htm/fruits/fruit-insect-disease/campylomma-bug97
  • Higbee, B.S. Campylomma verbasci (Hemiptera: Miridae) Mullein plant bug. In “Biological Control: a guide to natural enemies in North America” ed. A Shelton. College of Agriculture and Life Sciences, Cornell University. Retrieved October 14, 2011 from http://www.biocontrol.entomology.cornell.edu/predators/Campylomma.html" target="_blank"> http://www.biocontrol.entomology.cornell.edu/predators/Campylomma.html
  • McMullen, R. D., and C. Jong. 1970. The biology and influence of pesticides on Campylomma verbasci (Hemiptera: Miridae). The Canadian Entomologist 102: 1390-94.
  • Reding, M. E., E H. Beers, J. F. Brunner, and J. E. Dunley 2001. Influence of Timing and Prey Availability on Fruit Damage to Apple by Campylomma verbasci (Hemiptera: Miridae). Journal of Economic Entomology 94(1):33-38. 2001 doi: 10.1603/0022-0493-94.1.33
  • Thistlewood, H.M.A. et al. 1990. Seasonal abundance of the mullein plant bug, Campylomma verbasci (Hemiptera: Miridae), on apple and mullein in the Okanagan Valley. The Canadian Entomologist 122: 1045-58.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

 Holarctic.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Dušanka Jerinić-Prodanović, Ljiljana Protić

Source: ZooKeys

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Foodplant / sap sucker
nymph of Campylomma verbasci sucks sap of Alcea rosea

Foodplant / sap sucker
nymph of Campylomma verbasci sucks sap of Verbascum

Foodplant / sap sucker
nymph of Campylomma verbasci sucks sap of Solanum tuberosum

Foodplant / sap sucker
nymph of Campylomma verbasci sucks sap of Malus

Foodplant / sap sucker
nymph of Campylomma verbasci sucks sap of Quercus

Animal / predator
nymph of Campylomma verbasci is predator of Tetranychus urticae

Animal / predator
nymph of Campylomma verbasci is predator of Thrips

Animal / predator
nymph of Campylomma verbasci is predator of Aphidoidea

Animal / predator
nymph of Campylomma verbasci is predator of Insecta

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Campylomma verbasci

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTATATTTTTTATTTGGAATATGAGCAGGAATATTAGGTACATCTTTAAGATGAATCATCCGAATTGAATTAGGAATACCAGGATCATTCATTGGAAATGATCAAACATATAATGTAGTAGTAACAGCACATGCATTTATTATAATTTTCTTTATAGTTATACCAATCATAATTGGAGGATTTGGAAACTGATTAGTACCTTTAATAATTGGTGCTCCCGATATAGCCTTTCCTCGAATAAATAATATAAGATTCTGACTATTACCACCATCAATTACACTTTTAATTACTAGAAGTATTGTAGAAAATGGTGCAGGTACCGGATGAACAGTTTATCCCCCCTTATCATCAAATATCTCTCATGCAGGAGCATCTGTAGATTTAGCAATTTTCTCACTACATTTAGCAGGAATTTCATCAATTTTAGGAGCAGTAAACTTTATTTCAACAATCATTAATATACGACCGGAAGGTATAGTAGCAGAACGAATCCCACTATTCGTATGATCTGTAGGAATTACAGCACTATTACTACTTTTATCCTTACCTGTATTAGCAGGTGCAATTACTATATTATTAACAGATCGAAATTTTAATACATCATTTTTTGACCCTGCAGGGGGAGGGGATCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Campylomma verbasci

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!