Physical Description
Type Information
Holotype for Geocoris howardi Montandon, 1908
Catalog Number: USNM 44124
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Collector(s): O. Heidemann
Year Collected: 1888
Locality: Marquette; Mich, Michigan, United States
Catalog Number: USNM 44124
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Collector(s): O. Heidemann
Year Collected: 1888
Locality: Marquette; Mich, Michigan, United States
- Holotype: 240.
© Smithsonian Institution, National Museum of Natural History, Department of Entomology
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Geocoris howardi
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
AACATTATATTTTCTATTTGGAATATGATCAGGGATAATTGGATCTTCAATAAGATGAATTATTCGAGTAGAACTAGGACAACCAGGATCATTTATTGGAGATGATCAGATTTATAATGTAATTGTCACTGCTCACGCATTTATTATAATTTTTTTCATAGTAATACCTATTATAATTGGAGGGTTTGGTAATTGACTAGTACCATTAATGATTGGGGCTCCAGATATAGCATTCCCTCGTATAAATAATATATCATTTTGATTATTACCTCCATCATTAACTTTATTATTATCAAGAAGTATAGTAGAAATAGGAGCTGGAACAGGTTGAACAGTTTACCCTCCTTTATCAAATAGTTTATTTCACAGAGGAGCATCAGTAGATATAGCTATCTTTTCATTACACTTAGCGGGGGTAAGTTCTATTCTTGGAGCTATTAATTTTATTTCAACTATTATAAATATACGACCCGAAGGAATAACTCCTGAACAAATTCCTTTATTTGTATGATCAGTAGGAATTACTGCATTATTACTATTATTATCATTACCTGTTCTAGCAGGAGCTATTACAATATTATTAACAGATCGTAATATTAATACTTCCTTCTTTGACCCTACAGGAGGAGGGGATCCAATTCTATATCAACATTTATTC
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Geocoris howardi
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
