Physical Description

Type Information

Holotype for Geocoris howardi Montandon, 1908
Catalog Number: USNM 44124
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Collector(s): O. Heidemann
Year Collected: 1888
Locality: Marquette; Mich, Michigan, United States
  • Holotype: 240.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Geocoris howardi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTCTATTTGGAATATGATCAGGGATAATTGGATCTTCAATAAGATGAATTATTCGAGTAGAACTAGGACAACCAGGATCATTTATTGGAGATGATCAGATTTATAATGTAATTGTCACTGCTCACGCATTTATTATAATTTTTTTCATAGTAATACCTATTATAATTGGAGGGTTTGGTAATTGACTAGTACCATTAATGATTGGGGCTCCAGATATAGCATTCCCTCGTATAAATAATATATCATTTTGATTATTACCTCCATCATTAACTTTATTATTATCAAGAAGTATAGTAGAAATAGGAGCTGGAACAGGTTGAACAGTTTACCCTCCTTTATCAAATAGTTTATTTCACAGAGGAGCATCAGTAGATATAGCTATCTTTTCATTACACTTAGCGGGGGTAAGTTCTATTCTTGGAGCTATTAATTTTATTTCAACTATTATAAATATACGACCCGAAGGAATAACTCCTGAACAAATTCCTTTATTTGTATGATCAGTAGGAATTACTGCATTATTACTATTATTATCATTACCTGTTCTAGCAGGAGCTATTACAATATTATTAACAGATCGTAATATTAATACTTCCTTCTTTGACCCTACAGGAGGAGGGGATCCAATTCTATATCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Geocoris howardi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!