Ecology

Associations

In Great Britain and/or Ireland:
Foodplant / sap sucker
Nezara viridula sucks sap of live Phaseolus coccineus
Other: major host/prey

Foodplant / sap sucker
Nezara viridula sucks sap of live Herbaceous Plants

Foodplant / sap sucker
Nezara viridula sucks sap of live Broadleaved trees, shrubs and climbers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nezara viridula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGAATAAATGATTATATTCAACTAATCACAAAGATATTGGAACCTTATATTTCATATTTGGTATATGAGCAGGAATAGTAGGATCAGCAATAAGACTAATTATTCGAATTGAACTAGGACAACCCGGAAGATTTATTGGAGATGATCAAATTTATAATGTAGTAGTAACAGCTCACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATCATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATGATTGGTGCCCCAGATATAGCATTCCCTCGAATAAACAATATAAGATTCTGACTATTACCCCCATCATTAACCCTTTTAATAGTAAGAAGATTAGCAGAATCTGGAGCAGGGACAGGATGAACTGTTTATCCTCCTTTATCTAGTAACTTATCCCATAGAGGAGCTTCAGTGGATTTAGCTATTTTTTCATTACATCTAGCAGGAGTATCATCAATTTTAGGTGCAGTAAATTTCATTTCAACTATTATTAATATACGACCAACAGGCATAACTCCAGAACGAGTGCCACTATTTGTTTGATCAGTTGGAGTTACAGCACTATTATTACTACTTTCATTACCTGTACTAGCAGGTGCAATTACAATATTATTAACAGATCGAAACTTTAATACATCATTCTTTGATCCTTCAGGAGGGGGAGACCCCATTCTTTATCAACACTTATTTTGATTCTTTGGTCACCCTGAAGTTTACATTTTAATTTTACCAGGATTCGGATTAATTTCACATATTATTAGTCAAGAAAGAGGAAAAAACGAAACATTTGGAAATATAGGAATAATTTATGCTATATTAGCTATTGGAATTTTAGGATTCATCGTTTGAGCACACCATATATTCACAGTAGGAATAGACGTAGATACACGAGCATACTTCACTTCTGCAACTATAATCATCGCTGTTCCAACAGGAATCAAAATTTTTAGATGATTAGCAACTTTACATGGAGTTAAAATAAATTATTCTCCATCAATAATATGAGCATTAGGATTTGTATTTCTATTCACAATTGGAGGATTAACAGGAGTAATTTTGGCCAATTCATCAATTGATATTATTTTACATGATACCTATTATGTAGTAGCACATTTCCATTACGTTTTATCAATAGGAGCAGTATTTGCTATTATAGGAAGATTTATTCAATGATTTCCATTATTTACAGGAATAACATTAAACCCTAAATGATTAAAAATCCAATTTATTATTATATTTATAGGAGTAAATATCACATTTTTCCCTCAACACTTCCTAGGGTTAAGTGGCATACCTCGACGGTATTCAGATTATCCAGATAGATACACTAGATGAAATATTGTTTCATCAATTGGAAGAATTATATCAATAATTGGAATTATCATATTCATTATAATTTTATGAGAAAGATTAATTACAAAACGAGTAGTTATATTTAATGAAAATATAACATCAAGAATTGAATGAATACAAAAAACACCCCCATCAGAACATTCATATAATGAAATTCCTATATTAACATCAATCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nezara viridula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Nezara viridula

Nezara viridula, commonly known as the southern green stink bug (USA) or green vegetable bug (Australia and New Zealand), is a plant-feeding stink bug. Although believed to have originated in Ethiopia, it can now be found around the world.[1] Because of its preference for certain species of legumes, such as beans and soybeans, it is an economically important pest on such crops.[2]

Contents

Description [edit]

Adults are approximately a centimeter long, bright green and shield-shaped. They differ from the similar green stink bug (Acrosternum hilare) by the shape of their scent gland openings, which are short and wide in N. viridula, and narrow and long in the green stink bug.[1]

Life history [edit]

A fourth-instar larva

Nezara viridula reproduces throughout the year in tropics, and except for the winter time, in temperate zones as well. The female lays 30 to 130 eggs at a time, in the form of an egg mass glued firmly to the bottom of a leaf. The eggs are barrel-shaped, with an opening on the top.[1] The eggs take between 5 and 21 days to develop, depending on the temperature.[3] The newborn larvae gather near the empty eggs and do not feed until three days later, after the first moult. They moult five times before reaching maturity, increasing in size each time. Each instar stage lasts about a week, except for the last one before the metamorphosis, which is a day longer.[1] Up to four generations can develop in one year, with eggs developing into adults in as few as 35 days in mid-summer. Up until their third moult the larvae aggregate together on the host plant, the purpose of this aggregation is probably pooling of chemical defenses against predators, for example ants.[3]

Ecology [edit]

It is a highly polyphagous herbivore, able to feed on plants from over 30 families, both monocots and dicots.[3] It has a preference for legumes, preferring to feed on plants that are fruiting or forming pods.[3]

The most important factor limiting the population in temperate zones is winter cold. Mortality of overwintering individuals is between 30 and 80%, and the population cannot survive in areas where the average mid-winter temperature is below 5°C.[4] Females are more likely to survive the winter than males, as are larger individuals and those that develop reddish-brown coloration.[3] In recent decades, the species seems to be expanding its range towards the north, possibly because of global warming.[4][5] The animal's ability to survive the winter also depends on the timely onset of diapause.

Origin and range [edit]

Nezara viridula is a cosmopolitan species, living in tropical and subtropical regions of Americas, Africa, Asia, Australasia and Europe between 45 degrees north and 45 degrees south.[3] Its exact origin is unknown, but it is believed to have originated from the Ethiopia region of East Africa, from where it has spread around the world thanks to its strong flight and human trade routes.[3]

Varietas [edit]

Several distinct morphs can be distinguished by the pattern of their exoskeleton coloration. The back can be completely green in one morph, the other has three parallel white spots on the scutellum (Nezara viridula var. smaragdula), and the third has white or yellowish front margins on the head and the thorax (Nezara viridula var. torquata Fabricius, 1775).[6]

Nezara viridula var. smaragdula
Nezara viridula var. torquata

See also [edit]

References [edit]

  1. ^ a b c d Squitier J.M. (1997, updated 2007) »Southern green stink bug« Featured creatures, University of Florida Institute of Food and Agricultural services. Retrieved on 2008-10-14.
  2. ^ Panizzi A.R. et al. (2000). Stink bugs (Pentatomidae). In: Schaefer C.W. & Panizzi A.R. (eds.). Heteroptera of economic importance, str. 421-747. Boca Raton: CRC Press.
  3. ^ a b c d e f g Todd J.W. (1989). »Ecology and behavior of Nezara viridula«. Annu. Rev. Entomol. 34: 273-292. doi:10.1146/annurev.en.34.010189.001421
  4. ^ a b Musolin D.L. (2005). »The Southern Green Shield Bug Nezara viridula (L.) expands its distribution range, not only in the U.K.« Het News - Newsletter of the Heteroptera Recording Schemes. Retrieved on 2008-10-14.
  5. ^ Yukava J. et al. (2007). »Distribution range shift of two allied species, Nezara viridula and N. antennata (Hemiptera: Pentatomidae), in Japan, possibly due to global warming«. Applied Entomology and Zoology 42(2): 205-215
  6. ^ Biolib
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!