Overview

Comprehensive Description

Amphilophus citrinellus :

BMNH 1864.1.26.201-203 (3 syntypes ), Nicaragua , Lake Nicaragua ; UMMZ 180617 (7, 2 C&S, 6 dig.), UMMZ 188309 (7, 1 C&S, 1 skel., 6 dig.), Nicaragua , Lake Managua at Mateare ; UMMZ 197508 (10, 10 XR), Nicaragua , Jiloá [ Heros basilaris ZBK : BMNH 1905.3.27.4 ( cotype ), Nicaragua , Lake Nicaragua .]

  • Juan J. Schmitter-Soto (2007): A systematic revision of the genus Archocentrus (Perciformes: Cichlidae), with the description of two new genera and six new species. Zootaxa 1603, 1-78: 75-75, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:AFFCB590-1FC7-4CD0-950C-D1D1A6E59F6C
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Lives in box-cut canals with rocky vertical sides, crevices used for spawning and protection of the young (Ref. 5723). Found in lakes; uncommon in the rivers but will penetrate the lower river valleys where the water is slow flowing or tranquil (Ref. 7335). Omnivorous, eating mostly aufwuchs, snails and small fishes (Ref. 7335); also feeds on insect larvae, worms and other bottom-dwelling organisms (Ref. 44091). Majority of this fish has normal cryptic coloration (black, gray or brown), matching the substrate for camouflage and survival purposes. About 10 % of this species is xanthomorphic, undergoing a color metamorphosis at varying stages of growth (Ref. 7335). An experimental fish being used for behavioral studies (Ref. 4537).
  • Kullander, S.O. 2003 Cichlidae (Cichlids). p. 605-654. In R.E. Reis, S.O. Kullander and C.J. Ferraris, Jr. (eds.) Checklist of the Freshwater Fishes of South and Central America. Porto Alegre: EDIPUCRS, Brasil. (Ref. 36377)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Atlantic Slope of Nicaragua and Costa Rica. Introduced and established in canals near Homestead, Dade County, Florida. (Page and Burr 1991, Robins et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Central America: Atlantic slope of Nicaragua and Costa Rica (San Juan River drainage, including Lakes Nicaragua, Managua, Masaya and Apoyo).
  • Kullander, S.O. 2003 Cichlidae (Cichlids). p. 605-654. In R.E. Reis, S.O. Kullander and C.J. Ferraris, Jr. (eds.) Checklist of the Freshwater Fishes of South and Central America. Porto Alegre: EDIPUCRS, Brasil. (Ref. 36377)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Atlantic slope of Nicaragua and Costa Rica; introduced in U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 244 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

24.4 cm SL (male/unsexed; (Ref. 36377))
  • Kullander, S.O. 2003 Cichlidae (Cichlids). p. 605-654. In R.E. Reis, S.O. Kullander and C.J. Ferraris, Jr. (eds.) Checklist of the Freshwater Fishes of South and Central America. Porto Alegre: EDIPUCRS, Brasil. (Ref. 36377)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

This species coloration is mostly bright orange to orange-red in adults; mature males are of larger size, longer fins and with a distinct hump on their heads; aquarists usually refer to the lighter-colored, thin-lipped form as this species.
  • Yamamoto, M.N. and A.W. Tagawa 2000 Hawai'i's native and exotic freshwater animals. Mutual Publishing, Honolulu, Hawaii. 200 p. (Ref. 44091)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Box-cut canals with rocky vertical sides (presumably pertains to Florida, Page and Burr 1991). Spawns and young take shelter in crevices (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Lives in box-cut canals with rocky vertical sides, crevices used for spawning and protection of the young (Ref. 5723). Found in lakes; uncommon in the rivers but will penetrate the lower river valleys where the water is slow flowing or tranquil (Ref. 7335). Omnivorous, eating mostly aufwuchs, snails and small fishes (Ref. 7335); also feeds on insect larvae, worms and other bottom-dwelling organisms (Ref. 44091). Majority of this fish has normal cryptic coloration (black, gray or brown), matching the substrate for camouflage and survival purposes. About 10 % of this species is xanthomorphic, undergoing a color metamorphosis at varying stages of growth (Ref. 7335).
  • Conkel, D. 1993 Cichlids of North and Central America. T.F.H. Publications, Inc., USA. (Ref. 7335)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Sciadicleithrum Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Procamallanus Infection 13. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Spawn preferentially on the ceiling of natural caves (Ref. 38966). Deposit eggs on hard substrates, such as rocks or logs; both parents guarding the eggs and the fry for several weeks (Ref. 44091). 300-1000 eggs (Ref. 2060).
  • Lavery, R.J. 1991 Physical factors determining spawning site selection in a Central American hole nester, Cichlasoma nigrofasciatum. Environ. Biol. Fish. 31(2):203-206. (Ref. 38966)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amphilophus citrinellus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTACCTAATTTTTGGTGCTTGGGCCGGAATGGTAGGCACCGCATTAAGCCTATTAATCCGAGCAGAACTCAGCCAACCAGGCTCTCTCCTTGGAGACGACCAAATTTATAACGTAATTGTAACTGCACACGCCTTTGTAATAATCTTCTTTATAGTCATACCCATTATGATTGGGGGTTTCGGCAACTGACTGATTCCGCTCATGATTGGCGCCCCCGATATAGCCTTTCCACGAATAAACAATATGAGTTTTTGACTGCTTCCCCCCTCATTTCTCCTCCTCCTCGCTTCCTCAGGAGTTGAAGCTGGTGCTGGGACAGGATGAACCGTCTACCCTCCACTAGCAGGCAATCTGGCACATGCTGGCCCTTCAGTTGACCTAACCATCTTTTCCCTCCACTTAGCTGGAGTCTCATCCATTCTTGGAGCAATCAACTTCATCACCACAATTATTAACATAAAACCCCCAGCCATTTCCCAGTACCAGACACCCCTATTTATTTGAGCACTCTTAATTACTGCCGTCCTACTCCTACTGTCCCTTCCAGTCCTTGCCGCCGGCATTACTATGCTTTTAACGGACCGAAACCTAAACACAACCTTTTTTGACCCGGCAGGAGGCGGAGACCCCATTCTTTACCAGCATCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Amphilophus citrinellus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 3 specimens with morphological vouchers housed at Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 29 specimens with morphological vouchers housed at Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
  • Petrovicky, I. 1988 Aquarium fish of the world. Hamlyn Publishing Group Ltd., London. 499 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Amphilophus citrinellus

Amphilophus citrinellus is a large cichlid fish endemic to the San Juan River and adjacent watersheds in Costa Rica and Nicaragua. In the aquarium trade A. citrinellus is often sold under the trade name of Midas cichlid. A. citrinellus are omnivorous and their diet consists of plant material, molluscs and smaller fish. The species is closely related to but not to be mistaken as Amphilophus labiatus.

Two Midas Cichlids.

Physical characteristics[edit]

Midas Cichlids are heavily built and are capable of standing up to any other aquarium-sized cichlid in fights over territory. They have powerful jaws, sharp teeth and a physical size advantage in comparison to other aquarium species. Therefore, the aggressivity of Midas cichlids should not be underestimated and co-habitants should be chosen carefully in an aquarium setting.

Taxonomic status[edit]

Considerable debate over the taxonomic status of A. citrinellus began soon after the discovery of this species in the nineteenth century and continued throughout the twentieth century. A multivariate approach to treatment of anatomical characters has facilitated the discrimination among very similarly shaped species, aided by behavioral and ecological evidence. Multiple species of this group have been identified and verified by genomic and mitochondrial DNA evidence in volcanic crater lakes Apoyo (see Apoyo Lagoon Natural Reserve)[1][2] and Xiloa. The genetic evidence from Apoyo supports a hypothesis that the six known species of the lake evolved via sympatric speciation.[3] A few to perhaps several dozen species fitting the biological species concept are considered to exist among what has historically been called A. citrinellus, the great majority of which have not been described to date. The nine most recently described members of this species complex are considered endemic to their respective small, volcanic crater lakes.

Colouration in wild stocks is variable, with most specimens grey to olive brown with a characteristic pattern of black dorsolateral bars, some pink, white, yellow or orange specimens do occur. These brightly colored forms, often called "golds", exist in nature at varying frequencies throughout the range of the species group. Colorations and morphological characters (e.g. accentuated nuchal humps) seen in the hobbyist trade are the product of selective breeding for several generations and may not be reflected in the wild.

Conservation status[edit]

The conservation status of only one species of this group has been analyzed. The arrow cichlid (Amphilophus zaliosus) was evaluated as Critically Endangered by the IUCN Red List. Among the small body of information regarding populations of the species of this group, four other species may have smaller populations and/or ranges than this fish in Laguna de Apoyo: Amphilophus flaveolus, Amphilophus chancho, Amphilophus supercilius, and Amphilophus globosus. The final member of the complex, Amphilophus astorquii, constitutes about eighty percent of the breeding population of Laguna de Apoyo.[4]

See also[edit]

References[edit]

  1. ^ Stauffer JR, Jr., McCrary JK, & Black KE (2008): Three new species of cichlid fishes (Teleostei: Cichlidae) from Lake Apoyo, Nicaragua; PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON 121(1):117–129 [1]
  2. ^ Geiger MF, McCrary JK, & Stauffer JR, Jr. (2010): Description of two new species of the Midas cichlid complex (Teleostei:Cichlidae) from Lake Apoyo, Nicaragua; PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON 123(2):159–173 [2]
  3. ^ Geiger MF, McCrary JK, Schliewen U (2010): Not a simple case – A first comprehensive phylogenetic hypothesis for the Midas cichlid complex in Nicaragua (Teleostei: Cichlidae: Amphilophus); Molecular Phylogenetics and Evolution 56:1011-1024 [3]
  4. ^ McCrary JK, Lopez Perez LJ (2008): El monitoreo de las mojarras (Amphilophus spp.) en Nicaragua con aportes sobre su ecologia y estado de conservacion en la Laguna de Apoyo ; Revista Nicaraguense BIODIVERSIDAD 1:43-50 [4]
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!