Overview

Comprehensive Description

Description

 Sprattus sprattus grows up to 16 cm in length. It is shiny silver to grey in colour. It has a very forked tail and small and angular anal and dorsal fins. The dorsal fin is directly above the pelvic fin. The head is small and the lower jaw is upturned and projects slightly.Sprat may be confused with juvenile herring. The relative positions of dorsal and pelvic fins, the grey rather than blue coloration on the dorsal side and the sharply toothed ventral keel are, however, clear distinguishing features.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Usually inshore schooling, sometimes entering estuaries (especially the juveniles) and tolerating salinities as low as 4 ppt. Shows strong migrations between winter feeding and summer spawning grounds. Moves to the surface at night. Feeds on planktonic crustaceans (Ref. 9900). Spawns at depths of 10-20 m producing 6,000-14,000 pelagic eggs (Ref. 35388). Some spawn almost throughout the year, mainly in spring and summer, near the coast or up to 100 km out to sea, the young drifting inshore. Sold as 'brislings' to canneries. Sprat are used in the production of fish meal and as mink food, less for human consumption (Ref. 9900). Utilized fresh, smoked, canned and frozen; can be pan-fried and broiled (Ref. 9988).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution

Belgian Exclusive Economic Zone, Black Sea, Bredene, British Isles, European waters (ERMS scope), Greek Exclusive Economic Zone, Grevelingen, Irish Exclusive economic Zone, North Sea, Oosterschelde, Polish Exclusive Economic Zone, Portugese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Voordelta, Westerschelde, Wimereux, Zeeschelde
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northeast Atlantic: North Sea and Baltic south to Morocco; also the Mediterranean, Adriatic and Black seas.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 13 - 21; Analspines: 0; Analsoft rays: 12 - 23
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 160 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

16.0 cm SL (male/unsexed; (Ref. 188)); max. reported age: 6 years (Ref. 3561)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Lower jaw slightly projecting, gill cover without any bony radiating striae, teeth rarely present on vomer; belly with a strong keel of scutes; last two anal fin rays not enlarged. No dark spots on flanks. Pterotic bulla absent.
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 204979 specimens in 2 taxa.
Water temperature and chemistry ranges based on 102045 samples.

Environmental ranges
  Depth range (m): -9 - 262
  Temperature range (°C): 2.641 - 12.243
  Nitrate (umol/L): 1.139 - 16.868
  Salinity (PPS): 5.681 - 35.544
  Oxygen (ml/l): 0.573 - 8.768
  Phosphate (umol/l): 0.114 - 3.328
  Silicate (umol/l): 0.987 - 72.643

Graphical representation

Depth range (m): -9 - 262

Temperature range (°C): 2.641 - 12.243

Nitrate (umol/L): 1.139 - 16.868

Salinity (PPS): 5.681 - 35.544

Oxygen (ml/l): 0.573 - 8.768

Phosphate (umol/l): 0.114 - 3.328

Silicate (umol/l): 0.987 - 72.643
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 Sprat is a pelagic schooling fish usually found in inshore waters, sometimes entering estuaries to salinity values as low as 4. It can also be found down to a depth of up to 150 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 10 - 150m.
From 10 to 150 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-neritic; oceanodromous (Ref. 51243); brackish; marine; depth range 10 - 150 m (Ref. 6302)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Sometimes entering estuaries (especially the juveniles) and tolerating salinities as low as 4 o/oo; strong migrations between winter feeding and summer spawning grounds. Move to the surface at night.
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Sprattus sprattus (Sprattus sprattus spratt) is prey of:
Larus canus
Larus ridibundus
Larus argentatus
Larus marinus
Sterna sandvicensis
Sterna hirundo
Sterna paradisaea
Platichthys flesus
Hemiuris communis
Lecithaster gibbosus

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Sprattus sprattus (Sprattus sprattus spratt) preys on:
Copepoda

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Some spawn almost year round but mainly in spring and summer, near to the coast or up to 100 km out to sea, the young drifting inshore.
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sprattus sprattus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC7910-09|NC_009593|Sprattus sprattus| ACACGTTGATTTTTCTCAACTAATCACAAAGATATTGGTACCCTTTACCTAGTATTTGGTGCCTGAGCAGGAATGGTGGGCACAGCCCTA---AGTCTCCTAATTCGTGCAGAACTCAGCCAGCCTGGGGCCCTCCTTGGAGAT---GACCAGATCTATAATGTTATCGTTACTGCACATGCCTTCGTAATAATTTTCTTTATAGTAATGCCGATTCTAATTGGGGGGTTTGGAAACTGACTAGTTCCCCTCATG---GTCGGAGCACCAGATATGGCATTCCCTCGAATAAACAATATGAGCTTCTGACTACTCCCTCCCTCATTCCTCCTACTCTTAGCCTCCTCTGGGGTTGAAGCCGGAGCAGGGACTGGATGAACAGTATATCCCCCTCTGTCCGGTAACCTGGCCCACGCGGGGGCATCGGTTGATCTA---ACTATTTTTTCACTCCATCTAGCAGGTATTTCCTCTATTCTGGGTGCCATTAATTTCATTACTACAATTATTAATATGAAGCCGCCCTCAATTTCACAATACCAAACACCCCTGTTTGTCTGATCCGTACTTGTAACAGCTGTTCTACTTCTACTATCACTACCTGTACTAGCTGCC---GGGATTACAATGCTTCTTACAGATCGAAATCTAAACACCACCTTCTTCGACCCAGCAGGAGGGGGAGACCCAATTCTCTACCAACACCTATTTTGATTCTTCGGACACCCGGAAGTGTATATTCTCATTCTCCCCGGATTTGGAATGATTTCCCACATCGTAGCCTACTACGCAGGAAAGAAA---GAGCCCTTCGGATACATGGGAATGGTCTGAGCTATGATGGCTATCGGACTTCTAGGGTTCATTGTCTGAGCCCACCATATGTTCACCGTAGGTATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sprattus sprattus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 13
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; bait: usually; price category: Juveniles as white bait.; price reliability: low
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Baltic sprat

The Baltic sprat, Sprattus sprattus balticus is a herring-like, marine fish in the family Clupeidae. It is found in northeast Atlantic Ocean and most of the Baltic Sea, excluding the Bothnian Bay and eastern Gulf of Finland. Its length is up to 16 cm.

Young sprats are commonly known as brisling.

Canned sprats (usually smoked) are available in many north European countries, including the Baltic States, Scandinavia, Germany, Poland and Russia. They are an important Latvian export.


References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

European sprat

The European sprat, Sprattus sprattus, also known as bristling, brisling or skipper, is a small, herring-like, marine fish. Found in European waters, it has silver grey scales and white-grey flesh. Specific seas in which the species occurs include the Irish Sea, Baltic Sea and Sea of the Hebrides.[1] The fish is around 12% fat in its flesh and is a source of many vitamins. When used for food it can be canned, salted, fried, grilled, baked, marinated, and so on.

Young sprats are commonly known as brisling. Canned sprats (usually smoked) are available in many north European countries, including the Baltic states, Scandinavia, Ireland, Germany, Poland and Russia. They are an important Latvian export. The majority of brisling sardines that are sold to the public are harvested off the coasts of Norway and Scotland.

References

  1. ^ C.Michael Hogan, (2011) Sea of the Hebrides. Eds. P. Saundry & C.J.Cleveland. Encyclopedia of Earth. National Council for Science and the Environment. Washington DC.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!