Overview

Brief Summary

Acrida cinerea is a species in the silent slanted-face grasshopper subfamily (Acridinae).  The 40+ species in genus Acrida lack stridulatory organs on their legs, hence they are “silent.”  Acrida species are omnivorous; many are pests of agricultural crops including sorghum, wheat, rice, cotton, weed, sweet potato, sugar cane and Chinese cabbage in Africa, Europe, Asia, and Australia.  Acrida cinerea, found throughout China, Japan, South East Asia and Indonesia, is known commonly as the Chinese Grasshopper (though this name is also applied to Oxya chinensis, so can be confusing), Longheaded Grasshopper or Oriental Longheaded Locust.  It grows to 2-3 inches long, has a green or brown body, colorless hind wings and long legs that support long jumps and sustained flight.  Of the eight Acrida species that live in China, A. cinerea is the most widespread, and is found in abundance.  Historically it has been used as a human food source, recent studies have examined its nutritional value as a potential high quality and easy to rear oil source for the poultry industry.  Studies have also tested two nematode species as bio-control agents against A. cinerea populations in Chinese cornfields (Capinera 1999; Donovan 1842; Howie 2011; Wang et al. 2007; Zhong et al. 2001).

The mitochondrial genome of A. cinerea has been completely sequenced, and used for determining phylogenetic signal in mitochondrial DNA in the context of reconstructing relationships among orthopteran families.  As of 2010 20 other orthopteran mitogenomes had been sequenced as comparison (Liu and Huang 2010).

  • Capinera, J.L. 1999. Grasshoppers of Florida. University of Florida, Institute of Food and Agricultural Sciences. Retrieved April 29, 2013 from http://entnemdept.ufl.edu/ghopper/ghopper_toc.htm
  • Dirsh V. M. and B. P. Uvarov. Preliminary diagnoses of new genera and new synonymy in Acrididae. Anti-Locust Research Centre, British Museum (Natural History), London, England. Retrieved April 30, 2013 from http://biostor.org/reference/49689.text
  • Donovan, E. 1842. Natural History of the Insects of China. London, Henry G. Bohn, Yorkstreen, Covent Garden. Plate 10, Fig 1. Retrieved April 30, 2013 from http://www.biodiversitylibrary.org/item/35215#page/7/mode/1up
  • Howie, B. 2011. Xekopedia: An Encyclopedia of Animals. Scholastic Books. Pg 48.
  • Liu, N and Y. Huang, 2010. Sequence of Acrida cinerea (Acrididae: Orthoptera) and Comparative Analysis of Mitochondrial Genomes in Orthoptera. Comparative and Functional Genomics. Article ID 319486, 16 pages doi:10.1155/2010/319486Research
  • Wang, D. Zhai, S-W. Zhang, C-X, Zhang, Q., and H. Chen, 2007. Nutrition value of the Chinese grasshopper Acrida cinerea (Thunberg) for broilers. Animal Feed Science and Technology 135(1-2): 66-74.
  • Zhong, Y-L, Liu, C-H, and Z-M Zbeng, 2001. Transplantation of two mermithid nematodes to control insect pests in corn fields. Chinese Journal of Biological Control 17(2):57-59.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Dana Campbell

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acrida cinerea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CGAATAAATAACATAAGATTTTGATTATTACCACCATCATTAACCCTTCTCATTTCATCATCTATAGTAGATAGAGGAGTAGGTACAGGATGAACAGTGTACCCCCCACTAGCAGGAGCTATTGCTCATGGAGGAGCATCAGTAGACCTA---GCAATCTTCTCATTACATTTAGCAGGTATTTCATCAATCTTAGGTGCAGTAAACTTTATTACTACAGCAATTAATATACGATCAGAAAGAATAACATTAGATCAAACACCACTATTTGTTTGATCAGTATCAACTACTGCCCTTCTACTATTATTATCATTACCAGTTCTAGCAGGA---GCTATTACAATATTGTTAACTGATCGAAACTTAAATACATCTTTTTTTGACCCAGCAGGCGGGGGTGACCCAATTTTATATCAACATTTATTTTGATTCTTTGGGCACCCA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acrida cinerea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!