Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

Ranges from very shallow inshore areas or tide pools to depths of at least 45 m depth (Ref. 13539).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

South Pacific: Southwest Pacific: Lord Howe I. Southeast Pacific: Rapa I., Ducie Atoll, Easter I. and Desventuradas Is.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 375 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

37.5 cm TL (male/unsexed; (Ref. 13539))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

A plain-colored light brown moray with a black eye ring, white blotches around the last two infraorbital pores and last three mandibular pores, and a single branchial pore.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range 0 - 45 m (Ref. 13539)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 19 specimens in 1 taxon.
Water temperature and chemistry ranges based on 19 samples.

Environmental ranges
  Depth range (m): 1.5 - 17
  Temperature range (°C): 22.282 - 22.496
  Nitrate (umol/L): 0.120 - 0.139
  Salinity (PPS): 35.516 - 35.552
  Oxygen (ml/l): 5.027 - 5.079
  Phosphate (umol/l): 0.145 - 0.165
  Silicate (umol/l): 1.623 - 2.486

Graphical representation

Depth range (m): 1.5 - 17

Temperature range (°C): 22.282 - 22.496

Nitrate (umol/L): 0.120 - 0.139

Salinity (PPS): 35.516 - 35.552

Oxygen (ml/l): 5.027 - 5.079

Phosphate (umol/l): 0.145 - 0.165

Silicate (umol/l): 1.623 - 2.486
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 45m.
Recorded at 45 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gymnothorax australicola

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACCCTTTATCTTGTATTCGGCGCCTGGGCCGGCATGGTTGGGACCGCTCTTAGCCTGTTAATTCGAGCTGAGCTTAGCCAACCCGGAGCCCTTCTTGGAGACGACCAGATTTACAATGTTATCGTCACGGCACATGCCTTCGTAATAATCTTCTTTATAGTAATACCCCTGATAATTGGCGGGTTCGGAAACTGACTGGTGCCCCTAATGATTGGTGCCCCAGACATGGCATTCCCGCGGATAAATAATATAAGCTTTTGACTCCTCCCCCCCTCCTTTCTACTACTACTGGCCTCCTCTGGGGTAGAAGCTGGGGCAGGGACAGGCTGAACAGTCTACCCCCCTCTCGCAGGAAATCTTGCACACGCAGGTGCCTCCGTCGACCTCACTATTTTCTCACTTCACCTGGCTGGTGTATCTTCTATTTTGGGCGCAATCAACTTCATTACCACCATTATTAATATAAAACCCCCTGCAATTACACAATACCAAACACCCCTATTTGTATGAGCCGTACTTGTAACCGCCGTCCTACTACTACTATCTCTTCCAGTCTTAGCTGCGGGCATTACGATGCTACTGACCGACCGAAACCTTAATACAACCTTCTTCGACCCTGCCGGAGGCGGAGACCCAATTTTATATCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gymnothorax australicola

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

South Pacific moray eel

The South Pacific moray, Gymnothorax australicola, is a moray eel found in the southeast and southwest Pacific Ocean.[1] It was first named by Lavenberg in 1992.[1][2]

References[edit]

  1. ^ a b Gymnothorax australicola at www.fishbase.org.
  2. ^ Common names for Gymnothorax australicola at www.fishbase.org.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!