Overview

Comprehensive Description

General Description

Bugula stolonifera is an erect bryozoan that is mainly found on submerged structures in ports and harbours. The colonies are composed of greyish-buff dichotomous branches, arranged in a short dense compacted tuft, 3 – 4 cm high. Growth occurs via stolons spreading from the original point of settlement; secondary colonies arise from the stolons. The colonies lack the spiral branching patterns of superficially similar species such as B. avicularia, B. plumosa and B. turbinata. Autozooids are long and slender, typically 0.6 – 0.7 by 0.1 – 0.3 with two spines.

The species settles between June and October, or from April where water has been artificially warmed. It colonises hard substrates, typically submerged structures in marinas. It is distributed throughout the Atlantic and in the Mediterranean. Thought to be non-native in western Europe. It is known from Harwich (east coast of England), Swansea, Milford Have, Neyland and Cobh, Plymouth. Bugula stolonifera is also known from Venice Lagoon, where it tolerates reduced salinities and polluted waters, with low velocity currents.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Colonies of B. stolonifera are erect and branching. Young colonies take on a fan or funnel shape, while established colonies form dense tufts. Color is a grayish tan overall. Zooids of B. stolonifera are smaller than those of B. neritina, yet still taper proximally. They average 0.78 X 0.19 mm in size and have a U-shaped frontal membrane that occupies 3/4 of the frontal surface.Typical branching pattern in this species is Type 4. The outer distal corner of zooids is elongated into a large spine that often has 1 or 2 smaller spines directly below it. The inner distal corner also has a spine. Pedunculate avicularia, shaped like bird's heads, are located down the lateral edge of the frontal membrane. Round avicularia with decurved beaks occur in 3 size classes (Small, medium and large) depending on their position with respect to branch bifurcations. The lophophore bears 14 tentacles and is obliquely truncate, measuring an average of 0.441 mm in diameter.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Verdraagt verlaagde saliniteit en vervuiling. Deze soort wordt beschouwd als invasief en daarom is de eerste mogelijke melding in Nederland wel interessant: Horst (1885) in de voormalige Zuiderzee (Faasse, 1998). Loppens (1906) vermeldt deze soort nog niet van Nieuwpoort. Polk (1976) vond ze in de Spuikom van Oostende en vermeldt ze onder de naam B. avicularia. Algemeen in Belgische en Nederlandse jachthavens. Buiten havens aanwezig op strandhoofden (Koksijde) en aan de Noordzeekant van de Brouwersdam (de Kluijver, 1989) en in kanalen en afgesloten water in Zeeland (Faasse & De Blauwe, 2004). Ook gemeld van de NIOZ-haven op Texel in d’Hondt & Cadée (1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

B. stolonifera commonly occurs in both the eastern and western Atlantic Ocean, and the Mediterranean. In the western Atlantic, B. stolonifera occurs along the U.S. east coast from Massachusetts to Florida, through the Gulf of Mexico, to Brazil. B. stolonifera is a common fouling species along the Florida coast, and in the Indian River Lagoon. It has been collected from the Sebastian Inlet area, Link Port, and from other locations in the India River Lagoon. Along the Florida coast, it has been collected at Capron Shoals.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Individual zooids measure an average of 0.78 X 0.19 mm. The lophophore bears 14 tentacles and measures an average of 0.441 mm in diameter.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Vormt compacte bosjes tot 4 cm hoog. Vanuit de vestigingsplaats kan een uitloper vertrekken waarop secundaire bosjes ontspruiten. Kleur licht geelbruin tot grijs. De takjes bestaan uit twee zoïdenrijen. Zoïden lang en tenger. Het frontale oppervlak is voor de helft tot 3/4 membraneus. Stekelformule 2:1. Bij sommige kolonies zijn de stekels nauwelijks ontwikkeld. In het najaar werden kolonies aangetroffen met meer stekels, wat verwarring met andere soorten deed ontstaan. Polypide met 13 of 14 tentakels. De lengte van het avicularium is minder tot gelijk aan de zoïdenbreedte, wat lager dan de distale buitenstekel vastgehecht, de bek is omlaag gebogen. Broedkamers haast bolvormig. Embryo’s geel. Ancestrula met aan weerszijden distaal twee of drie stekels, proximaal één stekel. Tot 1998 in onze streek verkeerdelijk gedetermineerd als Bugula avicularia (Faasse, 1998 & Kerckhof, 2000), behalve door d’Hondt & Cadée (1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 18 specimens in 1 taxon.
Water temperature and chemistry ranges based on 12 samples.

Environmental ranges
  Depth range (m): 1 - 140
  Temperature range (°C): 9.189 - 27.099
  Nitrate (umol/L): 0.086 - 7.368
  Salinity (PPS): 32.968 - 38.201
  Oxygen (ml/l): 4.657 - 6.665
  Phosphate (umol/l): 0.085 - 0.841
  Silicate (umol/l): 1.379 - 5.019

Graphical representation

Depth range (m): 1 - 140

Temperature range (°C): 9.189 - 27.099

Nitrate (umol/L): 0.086 - 7.368

Salinity (PPS): 32.968 - 38.201

Oxygen (ml/l): 4.657 - 6.665

Phosphate (umol/l): 0.085 - 0.841

Silicate (umol/l): 1.379 - 5.019
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Alien species

De oorspronkelijke herkomst van het vogelkopmosdiertje Bugula stoloniferais onbekend. De soort wordt wereldwijd als exoot herkend als aangroei op scheepsrompen. De eerste Europese waarneming dateert van 1960 uit Groot -Brittannië. De soort werd voor het eerst in België waargenomen in 1976 in de Spuikom van Oostende. Later dook dit mosdiertje ook op in de havens van Oostende en Zeebrugge, en op strandhoofden in Koksijde. Het blijkt goed bestand tegen lage en wisselende zoutgehaltes en vervuiling, waardoor het goed kan gedijen in havens.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Alien species

The origin of Bugula stolonifera is unknown. The species is known worldwide as an exotic species and found on ship hulls. The first European observation dates from 1960 in Great Britain. The species was first observed in Belgium in the Ostend Sluice dock in 1976. It later emerged in the harbours of Ostend and Zeebrugge, and on the groynes of Koksijde. It appears to be resistant to low and changing salinity levels and pollution, whereby it can flourish in harbours.
  • VLIZ Alien Species Consortium
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

B. stolonifera, like all bryozoans, is a suspension feeder. Each individual zooid in a colony has 14 ciliated tentacles that are extended to filter phytoplankton less than 0.045 mm in size (about 1/1800 of an inch) from the water column. Bullivant (1967; 1968) showed that the average individual zooid in a colony can clear 8.8 ml of water per day.Habitats: Typical habitat for ectoprocts in the Indian River Lagoon include seagrasses, drift algae, oyster reef, dock, pilings, breakwaters, and man-made debris (Winston 1995). B. stolonifera in the IRL attaches to a wide variety of substrata, including B. neritina.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Seagrasses as well as floating macroalgae, provide support for bryozoan colonies. In turn, bryozoans provide habitat for many species of juvenile fishes and their invertebrate prey such as polychaete worms, amphipods and copepods. (Winston 1995).Bryozoans are also found in association with other species that act as support structures: mangrove roots, oyster beds, mussels, etc. B. stolonifera in the IRL typically occurs in association with B. neritina.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

B. stolonifera is among the most abundant species of bryozoa in the Indian River Lagoon. It is an important member of the fouling community.Locomotion: Sessile
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Growth

Yellow-brown embryos are brooded in subglobular ovicells. Larval settlement occurs from December to April.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bugula stolonifera

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TATTTTTTATTTGGCCTATGAGCTGGTATAGTTGGAAGAGGATTAAGTGCCTTAATTCGAGTAGAACTTAGTCAACCAGGAAGTTTACTAGGTAAT---GACCACCTTTATAACGTGATTGTTACAGCTCATGCCTTTTTAATAATTTTCTTTATAGTTATACCCGTAATAATTGGAGGATTTGGAAATTGATTAGTCCCTCTAATACTAGGATGCCCAGATATAGCTTTTCCACGACTAAATAATATAAGATTTTGACTTTTACCACCTGCACTAGCTCTATTACTAATATCTTCTTTAGTTGAAAGAGGAGCAGGTACAGGATGAACAGTATACCCTCCTTTATCATCTAGTCTCGGTCATAGTGGACCATCAGTTGATTTAGCAATTTTCTCCTTACACTTAGCTGGTGTCTCATCAATTTTAGGAGCAATTAATTTTATAACATCAACAATGAATATACGAAGAGGATCAATAACTATAATACATATCCCTCTATTAGTTTGAGCAGTTTTCATTACTGCTGTGTTACTACTACTATCTCTTCCAGTTCTAGCAGGCGCAATTACTATGCTGTTAACAGATCGAAATCTTAACACATCTTTTTTTGATCCTGCAGGAGGAGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bugula stolonifera

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Benefit in IRL: Bryozoans are ecologically important in the Indian River Lagoon due to their feeding method. As suspension feeders, they act as living filters in the marine environment. For example, Winston (1995) reported that bryozoan colonies located in 1 square meter of seagrass bed could potentially filter and recirculate an average of 48,000 gallons of seawater per day.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!