Articles on this page are available in 1 other language: Dutch (2) (learn more)

Overview

Comprehensive Description

General Description

Bugula neritina is an erect bryozoan that forms luxuriant tufts up to 8 cm high. The colonies are composed of dichotomous branches, which have a light spiral growth at the tip. The colonies are a vivid purplish-brown when alive, and a distinctive translucent brown when they have been preserved.

Autozooids are large and narrow towards the base. They lack spines or avicularia; all other British Bugula species have avicularia.

The species colonises a range of substrates including pier piles, ships’ hulls, buoys and similar artificial submerged structures, where it can reach a very high abundance. Small modified zooids which resemble rootlets (rhizoids) are used to attach to the colony to the substrate.

The species is recognised as a serious fouler, and can grow freely in ships’ intake pipe and condenser chambers. It settles readily on immersed test surfaces and has become invasive in New Zealand ports. The native range of the species remains uncertain. Today, B. neritina is widely distributed in warm-temperate and subtropical coastal waters. In Britain, it has been recorded from southern coasts, the east coast up to Lowestoft and on the west coasts as far as the Firth of Clyde.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

B. neritina is an erect, arborescent bryozoan whose colonies form brown or reddish tufts on whatever substratum they encounter. It is a common and abundant member of the fouling community (Winston 1995). Zooids are large and measure an average of 0.97 X 0.28 mm. Zooids alternate biserially on branches, with individual zooids tapering proximally. A membrane covers the frontal surface. B. neritina differs from other species in this genus in that it possesses no avicularia and no spines. Rather, its zooids have sharp points in the distal corners. The lophophore measures an average of 0.764 mm in diameter and bears 23 tentacles.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution

Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, British Isles, Burghsluis, European waters (ERMS scope), Gulf of Mexico, New Zealand Exclusive Economic Zone, North Sea, Oostende, Portugese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

B. neritina is a highly cosmopolitan and abundant species throughout warm water areas of the world and is considered a troubling fouling organism. B. neritina occurs throughout the Indian River Lagoon and along the Florida coast.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Zooids are large and measure an average of 0.97 X 0.28 mm. The lophophore measures an average of 0.764 mm in diameter and bears 23 tentacles.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 87 specimens in 2 taxa.
Water temperature and chemistry ranges based on 71 samples.

Environmental ranges
  Depth range (m): 0 - 4706
  Temperature range (°C): 2.513 - 27.099
  Nitrate (umol/L): 0.086 - 22.792
  Salinity (PPS): 34.901 - 38.547
  Oxygen (ml/l): 4.065 - 5.561
  Phosphate (umol/l): 0.085 - 1.519
  Silicate (umol/l): 1.193 - 44.576

Graphical representation

Depth range (m): 0 - 4706

Temperature range (°C): 2.513 - 27.099

Nitrate (umol/L): 0.086 - 22.792

Salinity (PPS): 34.901 - 38.547

Oxygen (ml/l): 4.065 - 5.561

Phosphate (umol/l): 0.085 - 1.519

Silicate (umol/l): 1.193 - 44.576
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

B. neritina, like all bryozoans, is a suspension feeder. Each individual zooid in a colony has 23 ciliated tentacles that are extended to filter phytoplankton less than 0.045 mm in size (about 1/1800 of an inch) from the water column. Bullivant (1967; 1968) showed that the average individual zooid in a colony can clear 8.8 ml of water per day.Habitats: Typical habitat for ectoprocts in the Indian River Lagoon include seagrasses, drift algae, oyster reef, dock, pilings, breakwaters, and man-made debris (Winston 1995).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Seagrasses as well as floating macroalgae, provide support for bryozoan colonies. In turn, bryozoans provide habitat for many species of juvenile fishes and their invertebrate prey such as polychaete worms, amphipods and copepods. (Winston 1995). Bryozoans are also found in association with other species that act as support structures: mangrove roots, oyster beds, mussels, etc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

B. neritina is one of the most abundant bryozoans in the IRL and an important member of the fouling community. It is most common in the winter months where it and B. stolonifera dominate bryozoan populations on hard substrata such as seawalls and docks (Winston 1995). It does however, show a fluctuating pattern of abundance. In some years it is a dominant species from late fall through late spring. In other years, it is sparsely distributed.Locomotion: Sessile
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

B. neritina has large ovicells that are attached to the distal corners of zooids and oriented at angles to the axis of the branch. In temperate waters, B. neritina reproduces in summer and fall. In the IRL, reproduction occurs in the cooler months. Older colonies appear to "over-summer." Winston (1982) reported that colonies collected coastally in June and July were brown in color and appeared to be nearly completely degenerated, with many zooids dead or filled with ciliates. However, closer examination revealed functional zooids present in the distal ends of the colony.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Embryos brooded in ovicells are dark brown in color and measure approximately 0.25 mm in diameter (Winston 1982).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Genomic DNA is available from 2 specimens with morphological vouchers housed at British Antarctic Survey
Public Domain

Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Bugula neritina

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 20 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBSP2895-11|AY690838|Bugula neritina| AAACGATGGTTCATATCCACTAACCATAAAGATATTGGTACATTATACTTTTTATTTGGACTATGAGCTGGGATAATTGGTAGAGGTTTA---AGAGCTCTTATTCGAGTAGAATTAAGACAACCAGGCAGCTTATTAGGTAAC---GACCAACTTTATAATGTAATTGTCACAGCTCATGCATTTTTAATAATTTTTTTTATAGTCATACCAGTTATAATTGGGGGGTTTGGAAATTGATTGGTTCCCTTGATA---CTGGGGGCTCCTGATATGGCATTTCCCCGCTTAAACAACATAAGATTTTGGCTTCTCCCTCCAGCATTATTACTTCTATTAATATCTTCTTTAGTAGAGAGGGGAGCTGGAACTGGGTGAACCGTATACCCTCCCTTATCATCGGGCTTAGGTCACAGAGGAGCAGCTGTGGATTTA---GCCATTTTATCTTTACACCTTGCCGGTGTATCCTCAATTTTAGGAGCAATTAACTTTATTACTACAACAATTAATATACGAAGAAACTCTATAAAAATAATTCAAATCCCTTTATTTATTTGGGCAGTTTTTATTACAGCCATTTTGTTACTTTTATCTTTACCAGTGCTAGCTGGA---GCTATTACTATACTACTAACCGATCGTAATGTTAATACATCTTTTTTTGACCCTGCTGGAGGGGGGGATCCTATTTTATACCAACACTTATTTTGGTTTTTTGGTCACCCCGAAGTATATATTTTAATTATCCCCGGATTTGGAATAATTTCACATATTATCAGAAACTCCAGGTCTAAAGAA---GAAGTATTTGGTGTAATCGGAATAATTTATGCTATGCTATCAATTGCACTCTTAGGATTCATTGTTTGAGGGCACCATATGTTTATGGTAGGGATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bugula neritina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Species: 10
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Benefit in IRL: Bryozoans are ecologically important in the Indian River Lagoon due to their feeding method. As suspension feeders, they act as living filters in the marine environment. For example, Winston (1995) reported that bryozoan colonies located in 1 square meter of seagrass bed could potentially filter and recirculate an average of 48,000 gallons of seawater per day.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!