Articles on this page are available in 1 other language: Dutch (2) (learn more)

Overview

Comprehensive Description

Description

 Bugula flabellata forms an erect, densely tufted, branched colony about 2-5 cm in height and is a buff colour when living, grey when dried. The branches are broad, flat and wedge-shaped, and composed of rows of four or more zooids, somewhat circularly disposed. Individual zooids are rectangular in shape and 0.5-0.8 x 0.2 mm. Zooids at the margin of the branches bear 3 spines on the outer distal corner and 2 on the inner distal corner. Inner zooids bear 2 spines on each distal corner. The front of the zooid is almost entirely membranous. The polypide has 14 tentacles. Avicularia are present on inner and marginal zooids, being larger on the latter, with the beak hooked rectangularly. Brood chambers (ooecia) are sub-globular and conspicuous. Colonies are attached to the substratum by extensions of the basal zooids termed rhizoids. Yellow embryos are present from early May to October. The newly settled larvae form ancestrula with 3 proximal spines and 3 spines on each distal angle.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Description

Bugula flabellata is an erect bryozoan that forms low dense tufts, between 2 – 3 cm in height. The colonies are made up of a number of fan-shaped shoots that are dichotomously divided into flat wedge-shaped branches, broadening at the tip. The branches are arranged in a somewhat circular manner and often slightly convoluted. When living the colony is of a buffish colour, but turns grey when dried.

The species almost invariably attaches to other bryozoans. Even when it is apparently growing on rock or shell, closer examination usually shows the exact site of attachment to be some species of encrusting cheilostomate bryozoan. Bryozoan species commonly supporting colonies of B. flabellata include Porella concinna, Schizomavella auriculata, Schizomavella linearis, Cellepora pumicosa, fronds of Flustra foliacea and lobes of Alcyonidium diaphanum. Small modified zooids which resemble rootlets (rhizoids) are used to attach to the colony to the substrate. The species often occurs as a co-dominant with Chartella papyracea in communities colonizing vertical shaded, sublittoral rock surfaces in the Bristol Channel.

Bugula flabellata is relatively common on the lower intertidal area of rocky shores, extending down to shallow inshore waters. The species apparently has a wide geographic distribution and occurs throughout the North Sea and off all British coasts.
The species appears to be a successful fowler, and its arrival and spread has been recorded in New Zealand ports. On the east coast of America, Bugula simplex was long mistaken for Bugula flabellata.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

lower St. Lawrence estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic, Belgian Coast, Belgian Exclusive Economic Zone, British Isles, Calais, Callantsoog, Egmond aan Zee, European waters (ERMS scope), Hinder Banks, Nieuwpoort, North West Atlantic, Northumberland, Scheveningen, United Kingdom Exclusive Economic Zone, USA, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from rocky shores.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

infralittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Occurs on the lower shore and shallow sublittoral rocky shore. Usually attached to other bryozoan species such as Porella concinna, Schizomavella auriculata, Schizomavella linearis and Cellepora pumicosa, as well as the fronds of Flustra foliacea and the lobes of Alcyonidium diaphanum.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bugula flabellata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTATATTTTTTATTTNNNTTATGATCTGGGATAATTGGAAGAGGNTTAAGAGCCCTAATTCGAGTAGAGCTAAGACAGCCCGGCAGATTATTAGGCAAC---GACCAACTCTATAATGTAATCGTGACANNNNNTGGATTCCTAATAATTTTCTTCATAGTTATACCAGTAATAATTGGGGGATTCGGAAACTGATTGGTCCCTCTTATACTGGGCTGCCCTGATATAGCTTTCCCCCGACTAAATAATATAAGATTTTGGCTTTTACCTCCCGCCTTAGCACTACTTTTAATATCTTCATTAGTAGAAAGGGGCGCCGGAACCGGATGGACTGTATACCCCCCTCTTTCATCTAACTTGGGACATAGAGGACCTTCCGTTGATCTAGCAATCTTTTCACTACATCTGGCTGGAGCCTCATCAATTTTAGGGGCTATCAACTTCATAACATCCACCTTAAACATACGAAATGAGTACATAACTATAATACACATTCCTCTTCTAGTATGGGCAGTCTTTATTACCGCAGTACTTCTGCTTCTATCCCTACCAGTCCTAGCAGGCGCCATTACAATACTACTAACCGACCGAAACCTAAACACATCCTTTTTTGACCCCGCAGNTGGTGGAGACCCTATTCTCTATCAACACCTCTTCTGATTTTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bugula flabellata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!