Articles on this page are available in 1 other language: Dutch (3) (learn more)

Overview

Brief Summary

Hornwrack is a flat, lobed colony of bryozoans. Every animal in the colony has its own task. Some are cleaners while others are responsible for providing food. Particularly in the spring, broken off pieces of a colony wash ashore regularly on the North Sea beaches. Living colonies that was ashore smell like lemon or rosemary. Therefore to determine whether or not a colony is fresh, you must smell it.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Taxonomy

This bryozoan forms bushy flexible colonies that are 6–20cm in height and light grey-brown in colour.The colony is bilaminar, flexible and divides into broad branch-like fronds.Short thick spines (4–5) are arranged around the edge of each autozooid, which is roughly rectangular in shape (0.4 by 0.28mm). The polypide has 13–14 tentacles.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Introduction

Flustra foliacea (Linnaeus, 1758) is a cheilostome marine bryozoan that is commonly found along the strand line, or high-tide mark, around the British coast especially after storms.It has a distinctive lemon-like smell when fresh.Known as the broad-leaved hornwrack, this bryozoan forms bushy flexible colonies 6–20cm in height, that are light grey-brown in colour.It is often mistaken for a seaweed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

During its first year of growth, the bryozoan encrusts the substratum forming a flat base before it starts to grow into an erect colony.Flustra forms annual growth lines, similar to rings in a tree, which show when it has lain dormant over the winter months, usually October to February (Eggleston, 1963).Colonies off the Welsh coast have been known to grow to at least 12 years of age (Stebbing, 1971).

Flustra and Robert Hooke
The microscopic structure of Flustra foliacea was first described in September 1665 by Robert Hooke (1635–1703). In the book, Micrographia, Hooke illustrated a variety of objects, some biological and some manmade, which he had viewed through various lenses. He was the first person to apply the word cell to biological objects.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Description

       

       

Flustra foliacea is a common bryozoan throughout the temperate NE Atlantic. Colonies are predominantly found in the subtidal, but may often be washed-up along the coastline, particularly after storms. F. foliacea forms bushy colonies with stiff brown or light grey fronds. Fresh colonies have a distinctive lemon-like smell and grow to between 6 and 20 cm.  F. foliacea attaches to hard substrates including stones and shells by an encursting basal portionof the colony. The colonies provide a microhabitat to a diverse assemblage of epifaunal species.

 
stra   foliacea is a common bryozoan throughout the temperate NE   Atlantic. Colonies are predominantly found in the subtidal, but may often be   washed-up along the coastline, particularly after storms. F. foliacea forms bushy colonies   with stiff brown or light grey fronds. Fresh colonies have a distinctive   lemon-like smell and grow to between 6 and 20 cm. The colonies provide a   microhabitat to a diverse assemblage of epifaunal species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 Flustra foliacea forms a stiff but flexible bushy clump 6 -10 cm high, occasionally up to 20cm high. Flustra foliacea is much divided into fronds that are usually broadly lobed, occasionally strap-like, and made up of zooids (individuals) on both sides (bilaminar). Fronds are light grey to brown in colour. Zooids are tongue shaped, 0.4 mm long and 0.2 - 0.28 mm wide. They bear 4 to 5 marginal club-like spines at the broad (distal) end of each zooid. The fronds have a distinct smell of lemons when freshly collected. Hornwrack is sometimes found washed ashore after storms.Flustra foliacea forms only a flat incrustation during its first year of growth, erect growth occurs in subsequent years. Fronds can often be encrusted by other bryozoans, hydroids and sedentary polychaetes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This bryozoan consists of branching flat fronds and is sometimes mistaken for a seaweed. Several other bryozoans are similar in shape and habit, but smaller. Securiflustra securifrons has narrower blades which tend to be divided into wedge-shaped segments.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

western slope of Newfoundland, including the southern part of the Strait of Belle Isle but excluding the upper 50m in the area southwest of Newfoundland
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Belgian Exclusive Economic Zone, British Isles, Calais, De Haan, Dutch Coast, Dutch Exclusive Economic Zone, European waters (ERMS scope), Flemish Banks, Hinder Banks, Irish Exclusive economic Zone, North Sea, North West Atlantic, Northumberland, Oostduinkerke, Oostende, United Kingdom Exclusive Economic Zone, Wimereux, Zeebrugge
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Colonies are abundant subtidally throughout the British Isles. The species is distributed from the Barents Sea and Greenland south, but is thought not to extend below northern Spain.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Common and widespread throughout the British Isles.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Colonies form a bushy clump of flat radiating fronds with terminally rounded lobes. Since F. foliacea is only lightly calcified, the colony as whole is flexible, allowing it move with the current. Zooids are approximately rectangular in shape and are arranged “back to back” to form bilaminar sheets. The frontal surface of the zooids is entirely membranous with no gymnocyst or cryptocuste preesnt. Four to five short, thick spines are arranged around the edge of the zooids. The polypide has13-14 tentacles and avicularia are present.

Colonies exhibit a degree of morphological plasticity, with frond width, and hence drag resistance, varying. Frond width is thought to be related to current speed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Colonies typically grow to between 6 and 20 cm. Zooids range from 0.4 by 0.2 -0.28 mm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

F. foliacea is often mistaken for seaweed, however, closer inspection of the fronds will reveal the very apparent zooids, confirming the colony as an animal species. Several other bryozoans are similar in shape and habitat to F. foliacea including other species of Flustra and Carbasea carbasea. In particular F. foliacea may be confused with Securiflustra securifrons (narrow-leaved hornwrack), but may be distinguished by broader fronds than S. securifrons. Additionally, the fronds of  S. Securifrons are typically divided into wedge-shaped segments, unlike F. foliacea.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

infralittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 434 specimens in 1 taxon.
Water temperature and chemistry ranges based on 156 samples.

Environmental ranges
  Depth range (m): 0 - 1150
  Temperature range (°C): 3.587 - 11.881
  Nitrate (umol/L): 1.242 - 16.298
  Salinity (PPS): 27.165 - 36.125
  Oxygen (ml/l): 4.209 - 7.160
  Phosphate (umol/l): 0.097 - 0.969
  Silicate (umol/l): 1.488 - 9.656

Graphical representation

Depth range (m): 0 - 1150

Temperature range (°C): 3.587 - 11.881

Nitrate (umol/L): 1.242 - 16.298

Salinity (PPS): 27.165 - 36.125

Oxygen (ml/l): 4.209 - 7.160

Phosphate (umol/l): 0.097 - 0.969

Silicate (umol/l): 1.488 - 9.656
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Flustra foliacea is a cold temperate species that is most frequently found on coarse grounds which have stable, fixed substrata and strong currents. Colonies, however, are able to colonise the majority of hard substrata such as shells, stones or cobbles. The species occurs subtidally, but is often washed on to the strand line. F. foliacea has been recorded from brackish environments in the Bay of Fundy, Baltic Sea and the Netherlands (Winston, 1977).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Found on coarse sediment and rocky substrate in the shallow sublittoral, where it favours current-swept rocky grounds.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

A typical species of sand-scoured areas, attached to bedrock, boulders and cobbles.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Like all bryozoans, F. foliacea is a suspension feeder. It feeds on small phytoplankton using ciliated tentacles of the lophophore.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Clumps of F. foliacea form a rich and diverse microhabitat, which provides a reasonably stable and perennial substrate for epizoobionts including other bryozoans species (e.g. Bugula, Scrupcellaria, Crisia and commonly Electra pilsoa). In the North Sea, the epizoobionts of F. foliacea can be divided into two distinct assemblages. In the northern North Sea, the assemblages are characterised by Amphiblestrum flemingii, Callopora dumerilii and Tricellaria ternate, while southern assemblages are characterised by Electra pilosa and Plagioecia patina. (Bitschofsky et al. 2011) Various predators, including sea urchins (Psammechinus miliaris), crabs, nudibranchs and  pycnogonids (Achelia echinata), feed on F. foliacea and its associated epifauna.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Distribution ecology

Flustra foliacea is a cold temperate species whose range does not extend below northern Spain.

Habitat
Flustra is most frequently found in cold water areas on stony grounds which have a stable, fixed substratum and strong currents.The clumps of Flustra form a rich and diverse microhabitat and support a dense assemblage of motile predators, such as:
  • sea urchins
  • crabs
  • nudibranchs
  • pycnogonids
Seven different phyla have been recorded from Flustra (Stebbing, 1971), but the most common epizoites are hydroids and other bryozoans such as Electra pilosa (L).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

The founding zooid (ancestrula) develops into a young colony, and later into an adult colony through asexual budding. Sexually produced embryos are brooded within the colony, before larvae are released. Larvae settle after liberation and metamorphose into an ancestrula.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Colonies are typically expected to live for around 12 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Female reproductive cells (ova) are orange in colour. They typically appear in August and move into the brood chambers (ovicells) during October. The sexually-produced embryos are brooded until larval release which commences in February. The larvae of F. foliacea are large non-feeding coronate larvae, which lack a shell and have a densely ciliated belt (the corona) for locomotion.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Colonies grow through asexual budding. The growing season extends from March to September, with colonies remaining dormant from October to February. During the first year of growth, colonies grow as flat incrustations on the substratum, with erect growth beginning from the second year onwards. Annual growth checks, in the form of lines across the frond surface are frequently visible, and can be useful in ageing a colony. Colonies are typically expected to live for around 12 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Natural History Museum, London

Source: Bryozoa of the British Isles

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Flustra foliacea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATAAGTATTACGCGTTGATTTATATCAACTAATCATAAAGACATTGGTACTTTGTATTTTATATTTGGTTTGTGGTCGGGGATAGTAGGGAGAGGATTAAGAGCTTTAATTCGAGCGGAATTAAGTCAATCGGGAGGTTTAATAGGTAATGATCAGCTTTACAATGTGATTGTTACGGCTCATGCTTTTTTGATAATTTTTTTTATAGTAATGCCGGTTATAATTGGAGGTTTTGGTAATTGGTTAATTCCTTTAATGCTTGGGGCTCCAGATATGGCTTTTCCACGTTTGAATAATATAAGGTTTTGACTTTTACCTCCTGCCTTAATCTTGTTACTTTTATCTTCCATGGTTGAGAGAGGAGCGGGAACCGGTTGAACTGTCTACCCTCCTTTGGCGTCGAATATTGCTCATAGAGGGGCTTCGGTAGATCTTGCTATTTTTTCTTTGCATTTAGCGGGGGTTTCTTCTATTTTAGGTGCTATTAATTTTATAACAACAGTGGTGAATATACGTAGAAAGATAATAACTATATTGTGTATTCCTTTGTTGGTGTGGGCGGTATTTATTACTGCTGTTTTATTATTACTTTCTTTACCTGTTTTGGCTGGAGCCATTACTATGTTATTGACGGATCGTAATTTGAATACTTCTTTTTTTGACCCAGCGGGGGGAGGGGATCCTATTTTGTATCAACATCTTTTTTGGTTTTTTGGTCATCCTGAGGTTTATATTCTTATTATTCCTGGCTTTGGTGTTATTTCGCATATTATTAGAAATTATAGGTCTAAAGAAGAGGTGTTTGGTGTGATGGGCATGATTTATGCTATAGTTTCTATTGCTTTATTGGGGTTTATTGTTTGGGGACATCATATGTTTATTGTTGGGATGGATATTGACACACGGGCTTATTTTACTTCTGCTACTATAGTTATTGCTGTACCGACAGGTGTAAAGGTTTTTAGGTGGTTATCCACAATAAATGGAAGAATTCCAACTTTTGGAGCTCCTATATTATGGGCATTAGGTTTTGTAGTATTGTTTACGTTTGGTGGACTAACAGGTATTGTTTTGGCCAATTCTTCTATTGATGTGGTTCTTCATGATACCTACTATGTTACTGCTCATTTTCATTACGTTTTAAGGATGGGTGCTGTTTTTACTATATTTGCTGGTTTTTCTTATTGGTTTCCTTTGTTTTGTGGTGTATCCTTGAATACTTATATGGCAAAAGCTCATTTTTATTTAACTTTTATTGGAGTAAATATGACTTTCTTTCCTCAGCATTTTTTAGGATTGGCTGGGATACCACGTCGTTACTCTGATTATCCTGATTCTATGAATACTTGAAATTTAATTTCTTCTTTTGGTTCTACTATTAGTTTCATTGGAGTGGCTATTTTTGTTACTATAGTGGTAGAGAGGTTGAGTAGGAAGCGGGTAGTTATTTTTGGGGATTCATCTTTTAATTCTTTGGACTGAGAAGATCGATTGCCTTTAGATTACCACAATCCTGAGGAAATGTTTTTGGTATACTACACCACTGCATAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Flustra foliacea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Flustra foliacea

Flustra foliacea is a species of bryozoan found in the northern Atlantic Ocean. It is a colonial animal that is frequently mistaken for a seaweed. Colonies begin as encrusting mats, and only produce loose fronds after their first year of growth. They may reach 20 cm (8 in) long, and smell like lemons. Its microscopic structure was examined by Robert Hooke and illustrated in his 1665 work Micrographia.

Contents

Taxonomic history

Scheme XIII from Robert Hooke's Micrographia: Figure 1 (top) shows the structure of Flustra foliacea.

Flustra foliacea was studied as early as 1665, when Robert Hooke published observations of various organisms and materials made with an early microscope.[1] It was first given a binomial name in 1758, when Carl Linnaeus included it in the 10th edition of his Systema Naturae as Eschara foliacea.[2] In later publications, Linnaeus divided bryozoans into more than one genus, and so the species came to be called Flustra foliacea. It is the type species of the genus Flustra.[3]

Description

Flustra foliacea is often mistaken for a seaweed, but is actually a colony of animals.[4] The fronds can reach a height of 20 centimetres (7.9 in) and have rounded ends.[4] They have a strong aroma of lemons.[4] It differs from the superficially similar Securiflustra securifrons by the tendency of the frond branches to become markedly wider towards the tip.[5] Each zooid is roughly rectangular, with 4–5 short spines at the distal end and 13–14 tentacles around the lophophore.[4]

Distribution and ecology

Flustra foliacea has a wide distribution in the north Atlantic Ocean, on both the European and American sides.[5] It is restricted to colder sublittoral waters, and reaches its southern limit in northern Spain.[6]

The fronds of Flustra foliacea are often used by other animals as a substrate to live on. Such epibionts include other bryozoa such as Crista eburnea, hydroids, sessile polychaete worms and the porcelain crab Pisidia longicornis.[4][7] Other animals feed on F. foliacea, including the sea urchins Echinus esculentus and Psammechinus miliaris and the nudibranch Crimora papillata; the pycnogonid Achelia echinata feeds preferentially on F. foliacea.[7]

Life cycle

Flustra foliacea colonies only grow in spring and summer, which can result in visible annual growth rings.[4] Breeding occurs between separate male and female zooids within the colony in autumn and winter.[4] The cells produce outgrowths known as ovicells, which contain embryos and are visible from October to February.[4] The larvae are released in spring and, after a short period, settle to the substrate. For the first year, colonies grow only along the surface (encrusting), with loose fronds only being formed in subsequent years.[4] These are produced when two encrusting colonies meet, and the two edges that make contact begin to grow upwards, back to back.[7] The total lifespan of a colony may reach 12 years.[4] It is frequently found washed up on beaches after storms.[8]

References

  1. ^ "Flustra foliacea (broad-leaved hornwrack): biology". Natural History Museum. Retrieved August 8, 2011. 
  2. ^ Hans G. Hansson (1999). "South Scandinavian marine "Lophophorata" check-list" (PDF). North East Atlantic Taxa. Tjärnö Marine Biological Laboratory. Retrieved August 8, 2011. 
  3. ^ J. S. Ryland (1969). "A nomenclatural index to 'A history of the British Marine Polyzoa' by T. Hincks (1880)". Bulletin of the British Museum (Natural History) 17: 207–260. 
  4. ^ a b c d e f g h i j John Fish & Susan Fish (2011). "Bryozoa (Ectoprocta)". A Student's Guide to the Seashore (3rd ed.). Cambridge University Press. pp. 382–393. ISBN 978-0-521-72059-5. 
  5. ^ a b Käre Telnes. "Greater Horn Wrack – Flustra foliacea". The Marine Flora & Fauna of Norway. Retrieved August 8, 2011. 
  6. ^ "Flustra foliacea (broad-leaved hornwrack): distribution". Natural History Museum. Retrieved August 8, 2011. 
  7. ^ a b c "Hornwrack – Flustra foliacea – Importance". Marine Life Information Network (MarLIN). Marine Biological Association of the United Kingdom. Retrieved August 8, 2011. 
  8. ^ "Flustra foliacea (broad-leaved hornwrack)". Natural History Museum. Retrieved August 8, 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!